Neurod2 (NM_010895) Mouse Untagged Clone

CAT#: MC209022

Neurod2 (untagged) - Mouse neurogenic differentiation 2 (Neurod2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Neurod2
• Synonyms: bHLHa1; Ndrf
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209022 representing NM_010895
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGACCCGCCTGTTCAGCGAGCCCGGCCTCCTCTCGGACGTGCCCAAGTTCGCCAGCTGGGGCGACG
  GCGACGACGACGAGCCGAGGAGCGACAAGGGCGACGCGCCGCCGCAGCCTCCTCCTGCTCCCGGGTCGGG
  GGCTCCAGGACCCGCCCGGGCCGCCAAGCCAGTGTCTCTTCGTGGAGGAGAAGAGATCCCTGAACCCACG
  TTGGCTGAGGTCAAGGAGGAAGGAGAGCTGGGCGGCGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGGAC
  TGGACGAGGCGGAAGGCGAGCGGCCCAAGAAGCGCGGGCCGAAGAAACGCAAGATGACCAAGGCGCGTCT
  GGAGCGCTCCAAGCTGCGGCGACAGAAGGCCAACGCGCGGGAGCGCAACCGCATGCACGACCTGAACGCG
  GCTCTGGACAACCTGCGCAAGGTGGTGCCCTGCTACTCCAAGACGCAGAAGCTGTCCAAGATCGAGACCC
  TGCGCCTGGCCAAGAACTACATCTGGGCTCTCTCGGAGATCTTGCGCTCCGGGAAGCGGCCGGATCTGGT
  GTCCTACGTGCAGACTCTGTGCAAGGGGCTGTCACAGCCCACCACGAATCTGGTGGCCGGCTGCCTGCAG
  CTAAACTCTCGTAACTTCCTCACGGAGCAGGGCGCGGACGGCGCCGGCCGCTTTCACGGCTCGGGTGGCC
  CGTTCGCCATGCATCCGTACCCATACCCGTGCTCCCGCCTGGCAGGCGCACAGTGTCAGGCGGCTGGCGG
  CCTGGGCGGAGGCGCGGCGCACGCCCTGCGGACCCACGGCTACTGCGCCGCCTACGAGACGCTGTACGCG
  GCGGCCGGTGGCGGCGGCGCTAGCCCGGACTACAACAGCTCCGAGTACGAGGGTCCACTCAGTCCCCCGC
  TCTGTCTCAACGGCAACTTCTCGCTCAAGCAGGACTCGTCCCCCGATCACGAGAAGAGCTACCACTACTC
  TATGCACTACTCGGCGCTGCCCGGCTCACGGCCCACGGGCCACGGGCTGGTCTTCGGCTCGTCGGCCGTG
  CGCGGGGGCGTCCACTCCGAGAATCTCTTGTCTTACGATATGCACCTTCACCACGATCGGGGCCCCATGT
  ACGAGGAGCTCAACGCATTTTTCCATAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010895
• Insert Size: 1152 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010895.3, NP_035025.3
• RefSeq Size: 3137 bp
• RefSeq ORF: 1152 bp
• Locus ID: 18013
• UniProt ID: Q62414
• Cytogenetics: 11 61.75 cM
• Gene Summary: Transcriptional regulator implicated in neuronal determination. Mediates calcium-dependent transcription activation by binding to E box-containing promoter. Critical factor essential for the repression of the genetic program for neuronal differentiation; prevents the formation of synaptic vesicle clustering at active zone to the presynaptic membrane in postmitotic neurons. Induces transcription of ZEB1, which in turn represses neuronal differentiation by down-regulating REST expression. Plays a role in the establishment and maturation of thalamocortical connections; involved in the segregation of thalamic afferents into distinct barrel domains within layer VI of the somatosensory cortex. Involved in the development of the cerebellar and hippocampal granular neurons, neurons in the basolateral nucleus of amygdala and the hypothalamic-pituitary axis. Associates with chromatin to the DPYSL3 E box-containing promoter.[UniProtKB/Swiss-Prot Function]