Nck1 (NM_010878) Mouse Untagged Clone

CAT#: MC209014

Nck1 (untagged) - Mouse non-catalytic region of tyrosine kinase adaptor protein 1 (Nck1), (10ug)


  "NM_010878" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nck1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nck1
Synonyms 6330586M15Rik; D230010O13Rik; Nck; Nck-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209014 representing NM_010878
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAAGAAGTGGTGGTGGTGGCCAAATTTGATTATGTGGCACAGCAGGAACAAGAGCTGGATATCA
AGAAGAATGAGCGATTATGGCTCCTGGATGACTCTAAATCCTGGTGGCGAGTTCGAAATTCCATGAATAA
AACAGGTTTTGTCCCTTCTAACTATGTGGAAAGAAAAAACAGTGCTCGGAAAGCATCTATTGTTAAAAAC
CTGAAGGACACCTTAGGTATTGGAAAAGTGAAAAGAAAACCCAGTGTTCCAGATACTGCATCTCCTGCTG
ATGATAGCTTTGTTGATCCAGGAGAACGTCTCTATGACCTTAACATGCCTGCTTTTGTGAAATTTAACTA
CATGGCTGAGAGAGAGGATGAGTTGTCATTGATAAAAGGGACCAAGGTGATCGTCATGGAGAAATGCAGT
GATGGATGGTGGCGTGGCAGCTACAACGGACAAATTGGATGGTTTCCTTCAAACTATGTAACTGAAGAAG
GTGACAGTCCTTTGGGTGATCATGTAGGTTCTCTGTCAGAGAAATTAGCAGCAGTTGTCAATAACCTAAA
TACGGGTCAAGTATTGCATGTTGTACAGGCTCTTTACCCGTTTAGCTCATCCAATGATGAAGAACTCAAT
TTTGAGAAAGGCGATGTAATGGATGTTATTGAAAAGCCGGAAAATGACCCAGAGTGGTGGAAATGCAGGA
AAATCAATGGCATGGTTGGCCTGGTGCCAAAAAACTACGTTACCATTATGCAAAACAATCCATTAACCTC
AGGTTTGGAACCATCTCCTCCACAATGTGATTACATTAGGCCTTCACTCACTGGGAAGTTTGCTGGCAAT
CCTTGGTATTATGGCAAAGTCACCAGGCACCAGGCAGAAATGGCATTAAATGAAAGAGGGCATGAAGGAG
ACTTCCTCATTCGTGACAGTGAATCTTCGCCAAATGATTTCTCAGTATCACTAAAAGCACAAGGGAAAAA
CAAGCATTTTAAAGTCCAGCTGAAAGAGACTGTTTACTGCATTGGGCAGCGGAAATTCAGCACCATGGAG
GAACTTGTAGAACATTACAAAAAGGCACCGATCTTTACAAGTGAGCAAGGAGAAAAATTATATCTCGTCA
AGCATTTGTCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010878
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010878.3, NP_035008.2
RefSeq Size 2467 bp
RefSeq ORF 1134 bp
Locus ID 17973
UniProt ID Q99M51
Cytogenetics 9 E3.3
Gene Summary Adapter protein which associates with tyrosine-phosphorylated growth factor receptors, such as KDR and PDGFRB, or their cellular substrates. Maintains low levels of EIF2S1 phosphorylation by promoting its dephosphorylation by PP1. Plays a role in the DNA damage response, not in the detection of the damage by ATM/ATR, but for efficient activation of downstream effectors, such as that of CHEK2. Plays a role in ELK1-dependent transcriptional activation in response to activated Ras signaling. Modulates the activation of EIF2AK2/PKR by dsRNA (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.