Gzmm (NM_008504) Mouse Untagged Clone

CAT#: MC208889

Gzmm (untagged) - Mouse granzyme M (lymphocyte met-ase 1) (Gzmm), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gzmm
• Synonyms: Lmet; Lmet1; MMET-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208889 representing NM_008504
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGTCTGCTGGTCCCTGCTGCTACTGCTGGCCCTGAAAACACTGTGGGCAGCAGGCAACAGATTTG
  AGACCCAGATCATTGGGGGTCGAGAGGCAGTCCCGCACTCCCGCCCATACATGGCCTCTCTACAGAAAGC
  CAAGTCCCATGTGTGTGGGGGAGTCCTTGTGCATCGGAAGTGGGTATTGACAGCTGCCCACTGCCTGTCT
  GAGCCGCTACAGAACCTGAAGCTGGTGCTTGGCCTGCACAACCTCCATGATCTCCAAGATCCTGGCCTCA
  CCTTCTACATCCGGGAAGCCATTAAACACCCTGGCTACAACCACAAATATGAGAACGACCTGGCACTGCT
  TAAGCTAGATAGACGAGTGCAGCCCAGCAAGAATGTCAAACCACTAGCTCTGCCAAGAAAGCCCCGATCC
  AAGCCGGCAGAAGGTACCTGGTGCAGCACAGCTGGCTGGGGAATGACCCACCAGGGTGGGCCCCGGGCCA
  GGGCCCTGCAGGAGTTGGATCTGCGTGTGCTGGATACCCAAATGTGTAACAACAGCCGCTTCTGGAACGG
  TGTCCTCATAGACAGCATGCTATGCTTAAAGGCTGGGAGCAAGAGCCAAGCCCCCTGCAAGGGTGACTCT
  GGAGGGCCCCTGGTGTGTGGCAAAGGCCAGGTGGATGGGATCCTGTCTTTCAGCTCCAAAACCTGCACAG
  ACATCTTCAAGCCACCTGTGGCCACTGCTGTAGCCCCCTACAGCTCCTGGATCAGGAAGGTCATTGGTCG
  CTGGTCACCCCAATCTTTGGTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008504
• Insert Size: 795 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_008504.3, NP_032530.1
• RefSeq Size: 1304 bp
• RefSeq ORF: 795 bp
• Locus ID: 16904
• Cytogenetics: 10 39.72 cM
• Gene Summary: The protein encoded by this gene is a member of a family of cytotoxic lymphocyte serine proteases called granzymes, which are expressed by cytotoxic T lymphocytes and natural killer cells. This protein belongs to a subfamily of granzymes that cleave after methionine residues. Natural killer cell development, homeostasis and cytotoxicity are normal in mice deficient for this gene, but they demonstrate increased susceptibility to murine cytomegalovirus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.