Klra2 (NM_001170851) Mouse Untagged Clone

CAT#: MC208833

Klra2 (untagged) - Mouse killer cell lectin-like receptor, subfamily A, member 2 (Klra2), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Klra2
• Synonyms: Klra30; Ly49; Ly49b
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208833 representing NM_001170851
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTGAGCAGGAGGTCACTTACACAACTCTGAGATTTCATAAGTCTTCAGGGTTGCAGAACCCAGTGA
  GGCCTGAGGAGACTCAAAGGCCCAGAGATGTGGGCCACAGAGAGTGTTCAGTCCCCTGGAAGTTCATTGT
  GATAGTTCTTGGAATCCTCTGTTTCCTTCTGCTGGTAACTGTGGCAGTGTTGGTGATACACATTTTCCGG
  GATGGACAAGAGAAACATGAACAGGAGAAAACTCTAAATAACCTCCGTCAAGAGTACCAGGTCATGAAAA
  ATGACAGCTCCTTAATGGAAGAAATGTTAAGAAATAAGTCTTCAGAGTGTAAGGCCCTCAATGATAGCCT
  GCACTACCTCAACAGAGAACAGAACAGATGCCTCAGGAAAACCAAGATTGTTTTAGATTGCTCACAGAAC
  AAAGGCAAGCAAGTGGAAGGATACTGGTTCTGCTGTGGCATGAAATGTTATTATTTCATCATGGATGATA
  AAAAATTGAAAGGATGTAAACAGATCTGCCAGGCTTACAACTTAACTCTTTTGAAGACAAATGATGAGGA
  TGAATTGAAGTTCCTTAAATCCCAACTTCAAAGAAACACATACTGGATTGCACTGACACATCACGAAAGC
  AAAGAGGAATCGCAACAGATTGGTGATAGACCATCTAAACCGGCTCAAGAAGAGCAAAGTTTCATTGAAG
  ATTTATCCCTCTGCCATCTCATCCCTGTGGATTTCTTTCCCTGGTTCATCTTCTCTGACACAGATTGTCA
  TGTTTCAGCAGCAAGGAATTCAGTACCTAATAGAGAAAAGTGTGCATATCTAAATTCATTTTCTACAGAA
  GAGGATGACCGTGCTAGAAATCATGGTTGTATTTGTGAAAAGAGATTGAATAAATTCCCTATTCCAGGGA
  GCTGTGCCAAGGGAAGAACTCAATCTGCTCTGCAGAGGGATGAAGATGAAAGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001170851
• Insert Size: 966 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001170851.1, NP_001164322.1
• RefSeq Size: 1886 bp
• RefSeq ORF: 966 bp
• Locus ID: 16633
• Cytogenetics: 6 63.44 cM
• Gene Summary: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.