Kcnq2 (NM_001006679) Mouse Untagged Clone

CAT#: MC208816

Kcnq2 (untagged) - Mouse potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2), transcript variant 11, (10ug)


  "NM_001006679" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Kcnq2 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Kcnq2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Kcnq2
Synonyms HNSPC; KQT2; Nmf134
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208816 representing NM_001006679
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGCAGAAGTCGCGCAACGGTGGCGTGTACCCCGGCACCAGCGGGGAAAAGAAGCTCAAGGTGGGCT
TCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACACGCGACGGCGCGCTACTCATCGCGGGCTCCGAGGC
CCCCAAGCGCGGCAGCGTTTTGAGCAAGCCGCGGACGGGCGGCGCGGGAGCCGGGAAGCCCCCGAAGCGC
AACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTAGAGCGGCCCCGCGGCTGGGCGTTCA
TCTACCACGCCTACGTGTTCCTTTTAGTCTTCTCCTGCCTTGTGCTTTCTGTGTTTTCCACCATCAAGGA
GTACGAGAAGAGCTCTGAGGGGGCCCTCTACATCTTGGAAATCGTGACTATCGTGGTATTCGGTGTTGAG
TACTTTGTGAGGATCTGGGCTGCAGGCTGCTGTTGCCGGTATCGAGGCTGGAGGGGCAGGCTCAAGTTTG
CCAGGAAGCCGTTCTGTGTGATTGATATCATGGTGCTGATTGCCTCCATTGCTGTGCTGGCTGCTGGTTC
CCAGGGCAATGTCTTTGCCACATCTGCGCTTCGGAGCTTGCGGTTCTTGCAAATCTTGCGGATGATCCGT
ATGGACCGGAGGGGTGGCACCTGGAAGCTCTTGGGATCGGTAGTCTACGCTCACAGCAAGGAGCTGGTGA
CTGCCTGGTACATTGGCTTCCTCTGCCTCATCCTGGCCTCATTTCTGGTGTACTTGGCAGAAAAGGGTGA
GAATGACCACTTTGACACCTACGCAGATGCACTCTGGTGGGGTCTGATCACCCTGACGACCATTGGCTAC
GGGGACAAGTACCCTCAGACCTGGAACGGGAGGCTGCTGGCAGCGACCTTTACCCTCATTGGTGTCTCGT
TCTTTGCTCTTCCTGCTGGCATTTTGGGATCCGGCTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAAAA
ACACTTTGAGAAACGGCGGAACCCTGCGGCAGGTCTGATCCAGGTGAGCCTTAGTCCCTGTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001006679
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006679.1, NP_001006680.1
RefSeq Size 1734 bp
RefSeq ORF 1044 bp
Locus ID 16536
Cytogenetics 2 103.57 cM
Gene Summary Associates with KCNQ3 to form a potassium channel with essentially identical properties to the channel underlying the native M-current, a slowly activating and deactivating potassium conductance which plays a critical role in determining the subthreshold electrical excitability of neurons as well as the responsiveness to synaptic inputs. Therefore, it is important in the regulation of neuronal excitability.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (11) differs in the 3' UTR and has multiple coding region differences (compared to variant 1), one of which results in a frameshift. This results in a shorter isoform (11) with a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.