Kcnj6 (NM_001025585) Mouse Untagged Clone

CAT#: MC208807

Kcnj6 (untagged) - Mouse potassium inwardly-rectifying channel, subfamily J, member 6 (Kcnj6), transcript variant Girk2B, (10ug)


  "NM_001025585" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal Anti-Kir3.2 (GIRK2)
    • 50 ul

USD 905.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Kcnj6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Kcnj6
Synonyms BIR1; GIRK2; KATP2; KCNJ7; Kir3.2; weaver; wv
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208807 representing NM_001025585
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAATGGCCAAGTTAACTGAATCCATGACTAACGTCTTGGAAGGCGATTCCATGGACCAGGATGTGG
AAAGCCCAGTGGCCATTCACCAGCCAAAGTTGCCTAAGCAGGCCAGGGACGACCTGCCGAGACACATCAG
CCGAGACAGGACCAAAAGGAAAATCCAGAGGTACGTGAGGAAGGATGGGAAGTGCAACGTTCACCACGGC
AATGTGCGGGAGACGTACCGATACCTGACGGACATCTTCACCACCCTGGTGGACCTGAAGTGGAGATTCA
ACCTGTTGATCTTTGTCATGGTCTACACAGTGACGTGGCTTTTCTTTGGGATGATCTGGTGGCTGATTGC
GTACATCCGGGGAGATATGGACCACATAGAGGACCCCTCGTGGACTCCTTGTGTCACCAACCTCAACGGG
TTTGTCTCTGCTTTTTTATTCTCCATAGAGACAGAAACCACCATCGGTTATGGCTACCGGGTCATCACGG
ACAAGTGCCCTGAGGGGATTATTCTCCTCTTAATCCAGTCCGTGTTGGGGTCCATTGTCAACGCCTTCAT
GGTAGGATGTATGTTTGTGAAAATATCCCAACCCAAGAAGAGGGCAGAGACCCTGGTCTTTTCCACCCAC
GCGGTGATCTCCATGCGGGATGGGAAACTGTGCTTGATGTTCCGGGTGGGGGACTTGAGGAATTCTCACA
TTGTGGAGGCATCCATCAGAGCCAAGTTGATCAAGTCCAAACAGACTTCAGAGGGGGAGTTTATTCCCCT
CAACCAGACTGATATCAACGTGGGGTACTACACAGGGGACGACCGGCTCTTTCTGGTGTCACCATTGATT
ATTAGCCATGAAATTAACCAACAGAGTCCCTTCTGGGAGATCTCCAAAGCGCAGCTGCCTAAAGAGGAAC
TGGAGATTGTGGTCATCCTGGAGGGAATGGTGGAAGCCACAGGTAAGATGGGTTTCGCCCTGGGTTTTCT
GTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025585
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025585.2, NP_001020756.1
RefSeq Size 2049 bp
RefSeq ORF 984 bp
Locus ID 16522
UniProt ID P48542
Cytogenetics 16 55.44 cM
Gene Summary This potassium channel is controlled by G proteins. It plays a role in granule cell differentiation, possibly via membrane hyperpolarization. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.