H2-Ea-ps (NM_010381) Mouse Untagged Clone

CAT#: MC208624

H2 (untagged) - Mouse histocompatibility 2, class II antigen E alpha, pseudogene (H2-Ea-ps), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: H2-Ea-ps
• Synonyms: AI323765; E-alpha-f; H-2Ea; H2-Ea; I-Ealpha; Ia-3; Ia3; MHC-H2-Ea
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208624 representing NM_010381
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCACAATTGGAGCCCTGCTGTTAAGATTTTTCTTCATTGCTGTTCTGATGAGCTCCCAGAAGTCAT
  GGGCTATCAAAGAGGAACACACCATCATCCAGGCGGAGTTCTATCTTTTACCAGACAAACGTGGAGAGTT
  TATGTTTGACTTTGACGGCGATGAGATTTTCCATGTAGACATTGAAAAGTCAGAGACCATCTGGAGACTT
  GAAGAATTTGCAAAGTTTGCCAGCTTTGAGGCTCAGGGTGCACTGGCTAATATAGCTGTGGACAAAGCTA
  ACCTGGATGTCATGAAAGAGCGTTCCAACAACACTCCAGATGCCAACGTGGCCCCAGAGGTGACTGTACT
  CTCCAGAAGCCCTGTGAACCTGGGAGAGCCCAACATCCTCATCTGTTTCATTGACAAGTTCTCCCCTCCA
  GTGGTCAATGTCACCTGGTTCCGGAATGGACGGCCTGTCACCGAAGGCGTGTCAGAGACAGTGTTTCTCC
  CGAGGGACGATCACCTCTTCCGCAAATTCCACTATCTGACCTTCCTGCCCTCCACAGATGATTTCTATGA
  CTGTGAGGTGGATCACTGGGGTTTGGAGGAGCCTCTGCGGAAGCACTGGGAGTTTGAAGAGAAAACCCTC
  CTCCCAGAAACTACAGAGAATGTCGTGTGTGCTCTTGGGTTGTTTGTGGGTCTGGTGGGCATCGTTGTGG
  GGATTATCCTCATCATGAAGGGTATTAAAAAACGCAATGTTGTAGAACGCCGACAAGGAGCCCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010381
• Insert Size: 768 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010381.2, NP_034511.2
• RefSeq Size: 887 bp
• RefSeq ORF: 768 bp
• Locus ID: 100504404
• UniProt ID: P04224
• Cytogenetics: 17 17.98 cM
• Gene Summary: This locus belongs to the class II major histocompatibility complex (MHC) family of genes, which encode immune response (Ia) antigens that function in the T-cell-dependent immune response. This family member has multiple haplotypes, some of which result in the production of an E-alpha subunit that combines with an E-beta subunit to form a functional E complex at the cell surface. Other haplotypes, including that of the reference genome allele, contain mutations and they thus represent polymorphic pseudogenes that do not produce functional products. These mutations include frameshifting indels, nonsense mutations, and deletions of larger regions. The reference genome haplotype contains a deletion at the 5' end of the gene, including the core promoter region and the transcription start site, and therefore no transcripts result from this haplotype. [provided by RefSeq, Aug 2011]