Gnai1 (NM_010305) Mouse Untagged Clone

CAT#: MC208563

Gnai1 (untagged) - Mouse guanine nucleotide binding protein (G protein), alpha inhibiting 1 (Gnai1), (10ug)


  "NM_010305" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gnai1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gnai1
Synonyms AU046200; Gialpha1; Gnai-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208563 representing NM_010305
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTGCACATTGAGCGCTGAGGACAAGGCGGCCGTGGAGCGCAGCAAGATGATCGACCGCAACCTCC
GGGAGGACGGCGAGAAGGCGGCGCGGGAGGTCAAGCTGCTGCTGCTGGGTGCTGGGGAATCTGGAAAGAG
TACCATTGTGAAGCAGATGAAGATTATCCACGAAGCCGGCTACTCGGAAGAGGAGTGTAAGCAGTACAAG
GCAGTGGTCTACAGCAACACTATCCAGTCCATCATTGCCATCATTAGAGCCATGGGGAGGTTGAAAATCG
ACTTCGGAGACTCTGCTCGGGCGGATGATGCTCGCCAACTTTTCGTGCTTGCTGGGGCTGCAGAAGAAGG
CTTTATGACTGCAGAGCTCGCCGGTGTCATAAAGAGACTGTGGAAAGACAGTGGTGTGCAAGCCTGCTTC
AACAGATCCCGGGAGTACCAGCTGAACGATTCGGCAGCGTACTATCTGAATGACTTGGACAGAATAGCAC
AGCCAAATTACATCCCAACTCAGCAGGATGTCCTCAGAACCAGAGTGAAGACCACAGGGATTGTGGAAAC
CCACTTTACCTTCAAAGATCTTCATTTTAAAATGTTTGACGTGGGAGGTCAGAGGTCAGAGCGGAAGAAG
TGGATCCACTGCTTTGAAGGGGTGACCGCCATCATCTTCTGTGTGGCCCTGAGTGACTATGACCTGGTTC
TTGCTGAAGATGAAGAAATGAACCGTATGCACGAGAGCATGAAGCTGTTCGATAGCATCTGTAACAACAA
GTGGTTTACAGACACGTCCATCATCCTTTTCCTCAACAAGAAGGACCTCTTCGAAGAAAAAATAAAAAAG
AGCCCCCTCACGATATGCTACCCAGAATATGCAGGCTCAAACACATATGAAGAAGCGGCCGCGTATATTC
AGTGTCAGTTTGAAGACCTCAATAAAAGGAAGGACACAAAGGAAATTTACACCCACTTCACGTGCGCCAC
AGATACGAAGAACGTGCAGTTCGTGTTCGATGCTGTAACAGACGTCATCATAAAGAATAACCTAAAAGAC
TGTGGTCTCTTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_010305
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC138862, AAI38863
RefSeq Size 3193 bp
RefSeq ORF 1065 bp
Locus ID 14677
UniProt ID B2RSH2
Cytogenetics 5 8.16 cM
Gene Summary Guanine nucleotide-binding proteins (G proteins) function as transducers downstream of G protein-coupled receptors (GPCRs) in numerous signaling cascades. The alpha chain contains the guanine nucleotide binding site and alternates between an active, GTP-bound state and an inactive, GDP-bound state. Signaling by an activated GPCR promotes GDP release and GTP binding. The alpha subunit has a low GTPase activity that converts bound GTP to GDP, thereby terminating the signal. Both GDP release and GTP hydrolysis are modulated by numerous regulatory proteins (By similarity). Signaling is mediated via effector proteins, such as adenylate cyclase. Inhibits adenylate cyclase activity, leading to decreased intracellular cAMP levels (By similarity). The inactive GDP-bound form prevents the association of RGS14 with centrosomes and is required for the translocation of RGS14 from the cytoplasm to the plasma membrane. Required for normal cytokinesis during mitosis. Required for cortical dynein-dynactin complex recruitment during metaphase (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.