Glycam1 (NM_008134) Mouse Untagged Clone
CAT#: MC208561
Glycam1 (untagged) - Mouse glycosylation dependent cell adhesion molecule 1 (Glycam1), (10ug)
"NM_008134" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Glycam1 |
Synonyms | glyCAM-1; MC26; Sgp50 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208561 representing NM_008134
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAATTCTTCACTGTCCTGCTATTTGTCAGTCTTGCTGCCACCTCTCTTGCTCTCCTGCCTGGGTCCA AAGATGAACTTCAAATGAAGACTCAGCCCACAGATGCCATTCCAGCTGCCCAGTCCACTCCCACCAGCTA CACCAGTGAGGAGAGTACTTCCAGTAAGGACCTTTCCAAGGAGCCTTCCATCTTCAGAGAAGAGCTGATT TCCAAAGATAATGTGGTGATAGAATCTACCAAGCCAGAGAATCAAGAGGCCCAGGATGGGCTCAGGAGCG GGTCATCTCAGCTGGAAGAGACCACAAGACCCACCACCTCAGCTGCAACCACCTCAGAGGAAAATCTGAC CAAGTCAAGCCAGACAGTGGAGGAAGAACTGGGTAAAATAATTGAAGGATTTGTAACTGGTGCAGAAGAC ATAATCTCTGGTGCCAGTCGTATCACGAAGTCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_008134 |
Insert Size | 456 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC145832, AAI45833 |
RefSeq Size | 645 bp |
RefSeq ORF | 456 bp |
Locus ID | 14663 |
UniProt ID | Q02596 |
Cytogenetics | 15 59.03 cM |
Gene Summary | Adhesion molecule that accomplishes cell binding by presenting carbohydrate(s) to the lectin domain of L-selectin.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region compared to variant 1. The encoded isoform (1) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221954 | Glycam1 (tGFP-tagged) - Mouse glycosylation dependent cell adhesion molecule 1 (Glycam1), (10ug) |
USD 350.00 |
|
MR221954 | Glycam1 (Myc-DDK-tagged) - Mouse glycosylation dependent cell adhesion molecule 1 (Glycam1) |
USD 150.00 |
|
MR221954L3 | Lenti ORF clone of Glycam1 (Myc-DDK-tagged) - Mouse glycosylation dependent cell adhesion molecule 1 (Glycam1) |
USD 450.00 |
|
MR221954L4 | Lenti ORF clone of Glycam1 (mGFP-tagged) - Mouse glycosylation dependent cell adhesion molecule 1 (Glycam1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review