Dlx5 (NM_010056) Mouse Untagged Clone

CAT#: MC208398

Dlx5 (untagged) - Mouse distal-less homeobox 5 (Dlx5), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dlx5
• Synonyms: AI385752
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208398 representing NM_010056
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACAGGAGTGTTTGACAGAAGAGTCCCAAGCATCCGATCCGGCGACTTCCAAGCTCCGTTCCCGACGT
  CCGCCGCCATGCACCACCCGTCTCAGGAATCGCCAACTTTGCCCGAGTCCTCGGCCACCGATTCTGACTA
  CTACAGTCCCGCGGGGGCCGCCCCGCACGGCTACTGCTCTCCTACCTCTGCTTCTTATGGCAAAGCGCTC
  AACCCCTACCAGTACCAGTACCACGGCGTGAACGGCTCCGCAGCCGGCTACCCGGCCAAGGCTTATGCCG
  ACTACGGCTACGCCAGCCCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCGAGTGCCACCAGCCA
  GCCAGAGAAAGAAGTGGCGGAGCCAGAGGTGAGGATGGTGAATGGTAAACCAAAGAAAGTTCGTAAACCC
  AGGACTATTTATTCCAGCTTTCAGCTGGCCGCTTTACAGAGAAGGTTTCAGAAGACTCAGTACCTCGCCC
  TGCCAGAACGCGCGGAGTTGGCCGCCTCTCTAGGACTGACGCAAACACAGGTGAAAATCTGGTTTCAGAA
  CAAAAGATCCAAGATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGC
  GACCCTATGGCGTGTAACTCGCCACAGTCACCAGCGGTGTGGGAGCCCCAGGGCTCATCCCGCTCTCTCA
  GCCACCACCCTCATGCCCACCCTCCGACCTCCAACCAGTCCCCCGCGTCCAGCTACCTGGAGAACTCGGC
  TTCCTGGTACCCAAGCGCAGCCAGCTCAATCAATTCCCACCTGCCACCGCCGGGCTCCTTGCAGCACCCG
  CTGGCACTGGCCTCCGGGACGCTTTATTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010056
• Insert Size: 870 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010056.2, NP_034186.2
• RefSeq Size: 1410 bp
• RefSeq ORF: 870 bp
• Locus ID: 13395
• UniProt ID: P70396
• Cytogenetics: 6 2.83 cM
• Gene Summary: Transcriptional factor involved in bone development. Acts as an immediate early BMP-responsive transcriptional activator essential for osteoblast differentiation. Stimulates ALPL promoter activity in a RUNX2-independent manner during osteoblast differentiation. Stimulates SP7 promoter activity during osteoblast differentiation. Promotes cell proliferation by up-regulating MYC promoter activity. Involved as a positive regulator of both chondrogenesis and chondrocyte hypertrophy in the endochondral skeleton. Binds to the homeodomain-response element of the ALPL and SP7 promoter. Binds to the MYC promoter. Requires the 5'-TAATTA-3' consensus sequence for DNA-binding.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).