Cbln1 (NM_019626) Mouse Untagged Clone
CAT#: MC208223
Cbln1 (untagged) - Mouse cerebellin 1 precursor protein (Cbln1), (10ug)
"NM_019626" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cbln1 |
Synonyms | AI323299 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208223 representing NM_019626
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGGGCGTCGTGGAGCTGCTGCTGTTGGGGACTGCGTGGCTGGCAGGCCCAGCCCGCGGGCAGAATG AGACAGAGCCCATCGTACTGGAGGGCAAGTGCCTGGTGGTGTGTGACTCCAACCCCACGTCTGACCCTAC GGGCACTGCTCTGGGCATCTCTGTGCGCTCCGGCAGCGCCAAGGTGGCTTTCTCTGCCATCAGGAGCACC AACCATGAGCCGTCCGAGATGAGTAATCGCACCATGATCATCTACTTCGACCAGGTACTAGTGAACATCG GGAACAACTTTGACTCAGAACGCAGCACTTTCATCGCCCCGCGCAAAGGCATCTACAGTTTTAACTTCCA CGTGGTGAAAGTCTACAACAGACAGACCATCCAGGTGAGCCTCATGTTGAACGGGTGGCCGGTGATTTCA GCCTTCGCCGGTGACCAAGACGTGACACGCGAGGCCGCCAGCAACGGCGTCCTCATCCAGATGGAGAAAG GCGACCGAGCATACCTCAAGCTGGAGCGGGGGAACTTGATGGGGGGCTGGAAGTACTCAACCTTCTCTGG ATTCCTCGTGTTTCCCCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019626 |
Insert Size | 582 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019626.3, NP_062600.2 |
RefSeq Size | 2345 bp |
RefSeq ORF | 582 bp |
Locus ID | 12404 |
UniProt ID | Q9R171 |
Cytogenetics | 8 42.16 cM |
Gene Summary | Required for synapse integrity and synaptic plasticity. During cerebellar synapse formation, essential for the matching and maintenance of pre- and post-synaptic elements at parallel fiber-Purkinje cell synapses, the establishment of the proper pattern of climbing fiber-Purkinje cell innervation, and induction of long-term depression at parallel fiber-Purkinje cell synapses (PubMed:16234806). Plays a role as a synaptic organizer that acts bidirectionally on both pre- and post-synaptic components (PubMed:20395510). On the one hand induces accumulation of synaptic vesicles in the pre-synaptic part by binding with NRXN1 and in other hand induces clustering of GRID2 and its associated proteins at the post-synaptic site through association of GRID2 (PubMed:21410790). NRXN1-CBLN1-GRID2 complex directly induces parallel fiber protrusions that encapsulate spines of Purkinje cells leading to accumulation of GRID2 and synaptic vesicles (PubMed:23141067). Required for CBLN3 export from the endoplasmic reticulum and secretion (PubMed:17030622, PubMed:17331201). NRXN1-CBLN1-GRID2 complex mediates the D-Serine-dependent long term depression signals and AMPA receptor endocytosis (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226558 | Cbln1 (tGFP-tagged) - Mouse cerebellin 1 precursor protein (Cbln1), (10ug) |
USD 500.00 |
|
MR226558 | Cbln1 (Myc-DDK-tagged) - Mouse cerebellin 1 precursor protein (Cbln1) |
USD 300.00 |
|
MR226558L3 | Lenti ORF clone of Cbln1 (Myc-DDK-tagged) - Mouse cerebellin 1 precursor protein (Cbln1) |
USD 600.00 |
|
MR226558L4 | Lenti ORF clone of Cbln1 (mGFP-tagged) - Mouse cerebellin 1 precursor protein (Cbln1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review