Cbln1 (NM_019626) Mouse Untagged Clone

CAT#: MC208223

Cbln1 (untagged) - Mouse cerebellin 1 precursor protein (Cbln1), (10ug)


  "NM_019626" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cbln1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cbln1
Synonyms AI323299
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208223 representing NM_019626
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGGGCGTCGTGGAGCTGCTGCTGTTGGGGACTGCGTGGCTGGCAGGCCCAGCCCGCGGGCAGAATG
AGACAGAGCCCATCGTACTGGAGGGCAAGTGCCTGGTGGTGTGTGACTCCAACCCCACGTCTGACCCTAC
GGGCACTGCTCTGGGCATCTCTGTGCGCTCCGGCAGCGCCAAGGTGGCTTTCTCTGCCATCAGGAGCACC
AACCATGAGCCGTCCGAGATGAGTAATCGCACCATGATCATCTACTTCGACCAGGTACTAGTGAACATCG
GGAACAACTTTGACTCAGAACGCAGCACTTTCATCGCCCCGCGCAAAGGCATCTACAGTTTTAACTTCCA
CGTGGTGAAAGTCTACAACAGACAGACCATCCAGGTGAGCCTCATGTTGAACGGGTGGCCGGTGATTTCA
GCCTTCGCCGGTGACCAAGACGTGACACGCGAGGCCGCCAGCAACGGCGTCCTCATCCAGATGGAGAAAG
GCGACCGAGCATACCTCAAGCTGGAGCGGGGGAACTTGATGGGGGGCTGGAAGTACTCAACCTTCTCTGG
ATTCCTCGTGTTTCCCCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019626
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019626.3, NP_062600.2
RefSeq Size 2345 bp
RefSeq ORF 582 bp
Locus ID 12404
UniProt ID Q9R171
Cytogenetics 8 42.16 cM
Gene Summary Required for synapse integrity and synaptic plasticity. During cerebellar synapse formation, essential for the matching and maintenance of pre- and post-synaptic elements at parallel fiber-Purkinje cell synapses, the establishment of the proper pattern of climbing fiber-Purkinje cell innervation, and induction of long-term depression at parallel fiber-Purkinje cell synapses (PubMed:16234806). Plays a role as a synaptic organizer that acts bidirectionally on both pre- and post-synaptic components (PubMed:20395510). On the one hand induces accumulation of synaptic vesicles in the pre-synaptic part by binding with NRXN1 and in other hand induces clustering of GRID2 and its associated proteins at the post-synaptic site through association of GRID2 (PubMed:21410790). NRXN1-CBLN1-GRID2 complex directly induces parallel fiber protrusions that encapsulate spines of Purkinje cells leading to accumulation of GRID2 and synaptic vesicles (PubMed:23141067). Required for CBLN3 export from the endoplasmic reticulum and secretion (PubMed:17030622, PubMed:17331201). NRXN1-CBLN1-GRID2 complex mediates the D-Serine-dependent long term depression signals and AMPA receptor endocytosis (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.