Mid1ip1 (NM_026524) Mouse Untagged Clone
CAT#: MC207653
Mid1ip1 (untagged) - Mouse Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) (Mid1ip1), transcript variant 2, (10ug)
"NM_026524" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mid1ip1 |
Synonyms | 3110038L01Rik; Mig12; S14R |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207653 representing NM_026524
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGCAAATCTGCGACACATATAACCAGAAGCACTCGCTCTTTAACGCCATGAATCGCTTCATTGGCG CGGTGAACAACATGGACCAGACGGTGATGGTGCCCAGTCTGCTGCGCGACGTACCCCTGTCCGAGCCGGA GATAGACGAGGTCAGCGTGGAGGTAGGCGGCAGTGGCGGCTGCCTGGAGGAGCGCACGACCCCGGCCCCA AGCCCGGGCAGCGCCAATGAAAGCTTTTTCGCGCCCTCCCGGGACATGTACAGCCACTACGTGCTGCTCA AGTCCATCCGCAATGATATCGAGTGGGGAGTCCTGCACCAGCCTTCGTCTCCGCCGGCCGGGAGCGAGGA GAGCACCTGGAAGCCCAAGGACATCCTGGTGGGCCTGAGTCACTTGGAGAGCGCGGATGCGGGCGAGGAA GATCTGGAGCAGCAGTTCCACTACCACCTGCGCGGGCTGCACACCGTGCTCTCCAAACTCACCCGAAAAG CCAACATCCTCACCAATAGATACAAGCAGGAGATCGGCTTCAGTAATTGGGGCCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026524 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_026524.4, NP_080800.1 |
RefSeq Size | 2056 bp |
RefSeq ORF | 549 bp |
Locus ID | 68041 |
UniProt ID | Q9CQ20 |
Cytogenetics | X A1.1 |
Gene Summary | Plays a role in the regulation of lipogenesis in liver. Up-regulates ACACA enzyme activity. Required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. Involved in stabilization of microtubules.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses a different splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201647 | Mid1ip1 (tGFP-tagged) - Mouse Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) (Mid1ip1) |
USD 500.00 |
|
MR201647 | Mid1ip1 (Myc-DDK-tagged) - Mouse Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) (Mid1ip1), transcript variant 2 |
USD 300.00 |
|
MR201647L3 | Lenti ORF clone of Mid1ip1 (Myc-DDK-tagged) - Mouse Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) (Mid1ip1), transcript variant 2 |
USD 600.00 |
|
MR201647L4 | Lenti ORF clone of Mid1ip1 (mGFP-tagged) - Mouse Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) (Mid1ip1), transcript variant 2 |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review