Timm13 (NM_013895) Mouse Untagged Clone

CAT#: MC207478

Timm13 (untagged) - Mouse translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Timm13
• Synonyms: D10Ertd378e; Tim9; Timm9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207478 representing NM_013895
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACAGCGGCTTCGGCTCGGATTTTGGCGGCACGGGTGGCGGGAAGCTGGACCCGGGGGCCATTATGG
  AGCAGGTGAAAGTGCAGATCGCCGTGGCCAACGCGCAGGAGCTGCTCCAGAGAATGACGGACAAGTGTTT
  CCGGAAGTGCATCGGGAAGCCCGGGGGCTCCTTGGATAACTCGGAGCAGAAATGCATCGCCATGTGCATG
  GACCGCTACATGGACGCCTGGAATACCGTGTCCCGCGCCTACAACTCTCGACTGCAGCGGGAACGAGCCA
  ACATGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013895
• Insert Size: 288 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_013895.4, NP_038923.1
• RefSeq Size: 1225 bp
• RefSeq ORF: 288 bp
• Locus ID: 30055
• UniProt ID: P62075
• Cytogenetics: 10 39.72 cM
• Gene Summary: Mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. Also required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space. The TIMM8-TIMM13 complex mediates the import of proteins such as TIMM23, SLC25A12/ARALAR1 and SLC25A13/ARALAR2, while the predominant TIMM9-TIMM10 70 kDa complex mediates the import of much more proteins (By similarity).[UniProtKB/Swiss-Prot Function]