Wnt5a (NM_009524) Mouse Untagged Clone

CAT#: MC207444

Wnt5a (untagged) - Mouse wingless-related MMTV integration site 5A (Wnt5a), (10ug)


  "NM_009524" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Wnt5a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Wnt5a
Synonyms 8030457G12Rik; Wnt-5a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207444 representing NM_009524
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAAGCCCATTGGAATATTAAGCCCGGGAGTGGCTTTGGGGACCGCTGGAGGTGCCATGTCTTCCA
AGTTCTTCCTAATGGCTTTGGCCACGTTTTTCTCCTTCGCCCAGGTTGTTATAGAAGCTAATTCTTGGTG
GTCTCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTATATATCATAGGTGCACAGCCTCTCTGCAGC
CAACTGGCAGGACTTTCTCAAGGACAGAAGAAACTCTGCCACTTGTATCAGGACCACATGCAGTACATTG
GAGAAGGTGCGAAGACAGGCATCAAGGAATGCCAGTACCAGTTCCGGCATCGGAGATGGAACTGCAGCAC
AGTGGACAATACTTCTGTCTTTGGCAGGGTGATGCAAATAGGCAGCCGAGAGACGGCCTTCACGTACGCG
GTGAGCGCAGCTGGGGTGGTGAACGCCATGAGCCGAGCATGCCGGGAGGGCGAGCTGTCTACCTGTGGCT
GCAGCCGCGCTGCGCGCCCCAAGGACCTGCCTCGGGACTGGTTGTGGGGCGGCTGCGGAGACAACATCGA
CTATGGCTACCGCTTCGCCAAGGAGTTCGTGGACGCTAGAGAAAGGGAACGAATCCACGCTAAGGGTTCC
TATGAGAGCGCACGCATCCTCATGAACTTACACAACAATGAAGCAGGCCGTAGGACAGTATACAACCTGG
CAGATGTAGCCTGTAAGTGTCATGGAGTGTCTGGCTCCTGTAGCCTCAAGACGTGCTGGCTGCAGCTGGC
GGACTTCCGGAAGGTGGGCGATGCCCTCAAGGAGAAGTATGATAGCGCGGCGGCCATGAGGCTCAACAGC
CGGGGCAAGCTGGTGCAGGTCAACAGCCGCTTCAACTCCCCGACCACGCAGGACCTGGTCTACATCGACC
CCAGTCCGGACTACTGTGTGCGCAACGAGAGCACTGGCTCGCTGGGCACGCAGGGACGCCTGTGCAACAA
GACCTCAGAGGGGATGGACGGCTGCGAGCTCATGTGCTGTGGGCGTGGCTATGACCAGTTTAAGACAGTG
CAGACCGAACGCTGTCATTGCAAGTTTCACTGGTGCTGCTATGTCAAATGCAAGAAGTGCACGGAGATTG
TGGATCAGTTCGTGTGCAAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_009524
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC018425, AAH18425
RefSeq Size 4354 bp
RefSeq ORF 1143 bp
Locus ID 22418
UniProt ID P22725
Cytogenetics 14 16.8 cM
Gene Summary Ligand for members of the frizzled family of seven transmembrane receptors (PubMed:17117926). Can activate or inhibit canonical Wnt signaling, depending on receptor context (PubMed:16602827). In the presence of FZD4, activates beta-catenin signaling. In the presence of ROR2, inhibits the canonical Wnt pathway by promoting beta-catenin degradation through a GSK3-independent pathway which involves down-regulation of beta-catenin-induced reporter gene expression (PubMed:16602827). Suppression of the canonical pathway allows chondrogenesis to occur and inhibits tumor formation. Stimulates cell migration (PubMed:17117926). Decreases proliferation, migration, invasiveness and clonogenicity of carcinoma cells and may act as a tumor suppressor. Mediates motility of melanoma cells (By similarity). Required during embryogenesis for extension of the primary anterior-posterior axis and for outgrowth of limbs and the genital tubercle (PubMed:10021340). Inhibits type II collagen expression in chondrocytes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.