Prkab1 (NM_031869) Mouse Untagged Clone

CAT#: MC207357

Prkab1 (untagged) - Mouse protein kinase, AMP-activated, beta 1 non-catalytic subunit (Prkab1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Prkab1
• Synonyms: 1300015D22Rik; AU021155; E430008F22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207357 representing NM_031869
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCAACACGAGCAGCGAGCGCGCCGCGCTGGAGCGGCAGGCGGGCCACAAGACGCCGCGGAGGGACA
  GCTCCGGGGGCGCCAAGGATGGGGACAGGCCCAAGATCCTCATGGACAGCCCTGAAGACGCCGACATCTT
  CCACTCCGAAGAGATCAAGGCTCCAGAGAAAGAGGAATTCCTGGCCTGGCAGCACGACCTGGAAGCGAAT
  GATAAAGCCCCCGCCCAGGCCCGGCCCACCGTGTTTCGATGGACAGGGGGTGGAAAGGAAGTCTACTTGT
  CTGGGTCCTTCAACAACTGGAGCAAGCTTCCCCTCACGAGAAGCCAGAATAACTTTGTAGCCATCCTGGA
  CCTGCCTGAAGGAGAGCATCAGTACAAGTTCTTCGTGGATGGACAGTGGACCCATGATCCTTCTGAGCCA
  ATAGTAACCAGCCAGCTTGGCACAGTTAACAACATCATTCAAGTGAAGAAAACTGACTTTGAAGTATTTG
  ATGCTTTAATGGTGGATTCCCAAAAGTGCTCCGATGTGTCTGAGCTGTCCAGCTCGCCCCCAGGACCCTA
  CCACCAGGAGCCTTACATGTCTAAACCAGAAGAGAGGTTCAAAGCCCCGCCCATCCTCCCGCCACACCTG
  CTGCAGGTCATCTTGAACAAGGACACGGGCATCTCTTGTGACCCAGCACTGCTTCCGGAGCCCAACCACG
  TCATGCTGAACCACCTCTATGCACTCTCCATCAAGGATGGAGTGATGGTGCTCAGTGCAACACACCGGTA
  CAAGAAAAAGTATGTCACCACCCTCCTCTACAAGCCGATATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031869
• Insert Size: 813 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_031869.2, NP_114075.1
• RefSeq Size: 2051 bp
• RefSeq ORF: 813 bp
• Locus ID: 19079
• UniProt ID: Q9R078
• Cytogenetics: 5 F
• Gene Summary: Non-catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism. In response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate and lipid biosynthesis, as well as cell growth and proliferation. AMPK acts via direct phosphorylation of metabolic enzymes, and by longer-term effects via phosphorylation of transcription regulators. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton; probably by indirectly activating myosin. Beta non-catalytic subunit acts as a scaffold on which the AMPK complex assembles, via its C-terminus that bridges alpha (PRKAA1 or PRKAA2) and gamma subunits (PRKAG1, PRKAG2 or PRKAG3) (By similarity).[UniProtKB/Swiss-Prot Function]