Slc25a37 (BC040399) Mouse Untagged Clone

CAT#: MC207102

Slc25a37 (untagged) - Mouse solute carrier family 25, member 37 (cDNA clone MGC:28425 IMAGE:4037680), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Slc25a37
• Synonyms: 1700020E22Rik; 4930513O14Rik; 4930526G11Rik; AI848481; C330015G08Rik; frascati; Mfrn; Mfrn1; mitoferrin; Mscp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC040399
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCACCCTACTCCACGATGCAGTAATGAATCCAGCAGAAGTGGTGAAACAGCGCTTACAGATGTACA
  ACTCCCAGCACCAGTCAGCCTTCAGTTGTATCCGGACAGTGTGGCGGACCGAGGGGTTGGGGGCCTTCTA
  CAGGAGTTACACCACACAGCTGACCATGAATATCCCCTTCCAGTCAATTCACTTCATCACCTATGAGTTT
  CTGCAGGAGCAAGTCAACCCTCGCCGGGACTACAACCCACAGTCTCACATCATCTCAGGAGGCCTGGCCG
  GGGCACTGGCCGCAGCTGCCACCACCCCGCTGGACGTCTGCAAAACCCTCCTCAACACGCAGGAGAACAT
  GGCTCTCTCCCTGGCCAACGTCAGCGGCCGGCTGTCGGGCATGGCCAATGCCTTCCGGACGGTGTACCAG
  CTCAACGGCCTTGCCGGCTATTTCAAAGGCATCCAGGCTCGAGTCATCTACCAGATGCCTTCCACCGCCA
  TCTCCTGGTCCGTTTATGAGTTCTTCAAGTACATCCTTACAAAGAGGCAGCTGGAGAATCGAACTCTGTA
  CTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC040399
• Insert Size: 564 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC040399, AAH40399
• RefSeq Size: 4000 bp
• RefSeq ORF: 563 bp
• Locus ID: 67712
• Cytogenetics: 14 D2
• Gene Summary: Mitochondrial iron transporter that specifically mediates iron uptake in developing erythroid cells, thereby playing an essential role in heme biosynthesis. The iron delivered into the mitochondria, presumably as Fe(2+), is then probably delivered to ferrochelatase to catalyze Fe(2+) incorporation into protoprophyrin IX to make heme.[UniProtKB/Swiss-Prot Function]