Scn2b (BC092225) Mouse Untagged Clone

CAT#: MC206948

Scn2b (untagged) - Mouse sodium channel, voltage-gated, type II, beta (cDNA clone MGC:116602 IMAGE:6839081), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Scn2b
• Synonyms: 2810451E09Rik; AI840361; Gm183
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206948 representing BC092225.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGTCTCACGGGGCTCAGTCTGTTTTTCTCTTTG
  GTGCCCCCGGGGCGGAGCATGGAAGTCACAGCGCCCACCACTCTTAGTGTCCTCAATGGGTCCGATACC
  CGCCTGCCCTGTACCTTCAACTCCTGCTACACCGTGAACCACAAGCAGTTCTCTCTTAACTGGACTTAC
  CAGGAGTGTAACAATTGCACAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATTAACCTGAAGCTG
  GAGCGGTTTGGAGACCGCGTGGAGTTCTCAGGGAACCCCAGTAAGTACGACGTGTCAGTGACTCTAAAG
  AACGTGCAGCTAGAAGACGAAGGCATTTACAACTGCTACATTACCAACCCTCCAGACCGCCACCGCGGC
  CACGGCAAGATTTACCTGCAGGTCCTTCTAGAAGTACCCCCAGAGCGGGACTCCACGGTGGCGGTCATC
  GTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGG
  AGGAAAAAAGAGCAGAAGCTGAGCACGGATGACCTGAAGACTGAAGAGGAAGGCAAGATGGATGGTGAG
  GGCAACGCGGAAGATGGCACCAAGTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: BC092225
• Insert Size: 648 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC092225
• RefSeq Size: 3980 bp
• RefSeq ORF: 647 bp
• Locus ID: 72821
• Cytogenetics: 9 24.84 cM
• MW: 24.2 kDa
• Gene Summary: Crucial in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. The subunit beta-2 causes an increase in the plasma membrane surface area and in its folding into microvilli. Interacts with TNR may play a crucial role in clustering and regulation of activity of sodium channels at nodes of Ranvier (By similarity).[UniProtKB/Swiss-Prot Function]