Trfp (BC060122) Mouse Untagged Clone
CAT#: MC206881
Trfp (untagged) - Mouse Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) (cDNA clone MGC:63299, (10ug)
"BC060122" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Trfp |
Synonyms | 1110011O05Rik; 2410115I17Rik; AU018348; Trfp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206881 representing BC060122.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGAGTGACGTGTGTGTCCCAGATGCCTGTGGCTGAGGGCAAGAGTCTCCAGCAGACAGTGGAGCTC CTCACCAAGAAACTGGAGATGCTTGGAGCAGAGAAACAAGGGACATTTTGTGTGGACTGTGAGACTTAC CACACAGCTGCCTCTACCCTGGGCAGCCAAGGCCAGGCTGGGAAGCTGATGTACGTGATGCATAACTCT GAGTACCCACTGAGCTGCTTTGCCCTCTTTGAGAATGGCCCTTGCCTCATTGCTGACACCAACTTCGAT GTGCTTATGGTGAAGCTCAAGGGCTTCTTCCAGAGTGCCAAGGCCAGCAAGATTGAGACCCGGGGCACT CGCTACCAGTATTGTGACTTCCTGGTGAAGGTGGGCACGGTCACAATGGGGCCCAGTGCCCGTGGCATC TCTGTGGAGGTAAGACCTTGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC060122 |
Insert Size | 438 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC060122 |
RefSeq Size | 5774 bp |
RefSeq ORF | 437 bp |
Locus ID | 56771 |
Cytogenetics | 17 C |
MW | 15.9 kDa |
Gene Summary | Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200965 | Trfp (tGFP-tagged) - Mouse Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) (cDNA clone MGC:63299 |
USD 350.00 |
|
MR200965 | Trfp (Myc-DDK-tagged) - Mouse Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) (cDNA clone MGC:63299 |
USD 150.00 |
|
MR200965L1 | Lenti ORF clone of Trfp (Myc-DDK-tagged) - Mouse Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) (cDNA clone MGC:63299 |
USD 450.00 |
|
MR200965L2 | Lenti ORF clone of Trfp (mGFP-tagged) - Mouse Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) (cDNA clone MGC:63299 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review