1110032A13Rik (BC064066) Mouse Untagged Clone

CAT#: MC206723

1110032A13Rik (untagged) - Mouse RIKEN cDNA 1110032A13 gene (cDNA clone MGC:73646 IMAGE:935634), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name 1110032A13Rik (BC064066) Mouse Untagged Clone
Symbol 1110032A13Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC064066
TGGTAGTCTAGGGCTTACACGCGGGTCCGTCCTGCGCCCACTCGTGTTTGCGGGCCCCGCGCCCCGAAGC ATGTGGGCCGGCGTCGCGGGGCTGAGAGGCTCCTGCGCCGGGCTGCAGGCTCTGTGGGGCGGCCACAGGG CTGCGCTTCTTCTCGGCCGCTCGCCGGCCCTGCACACCTCGGTCGCCTCCTGCGGCAGCAAGAACTTGCT CAAGAAATTTGCTTCGAAAACCAGGAAGAAGTTTTGGTATGAAGGTCCCTCCCTGGGGTCTCACTTGACC CCCAGGCCATCCAAGCATGAGTTCCTCACGAAGACCACCTCAAAGAAGACTAGGAAGGAAGACAGCATCC GCCTGAGGGTCCTGAACGGCCTTCTCTACAAATCATTGACGGAACTGCTGTGCACTCCTCAAGTGAGCCA GGAGGTCTACGACCTGAATGTGGAGCTGTCCAAGGTCTCTGTGACTTCAGACTTCTCAGCCTGCCGAGTG TACTGGAAGACGGGGGTCTCTGCGGAGCAGAACAAGCACACGGAGTCGGTGCTGCAGAGGAGCGCTGCCT ACATGAGGCATCTTCTGATATCTCAGCAAACCCTGAGAAATGTTCCACCCATAGTGTTTGTTCAAGACAA AAGAGACTTGGTCCTGGCTGAGGTAGATCGGTTGCTGGCAGAGGCTGACTTTGGACCCCCAGATGAAAGG GACGACTTGGACGGTTTGAGGAACGCCGATGCCCAGGTACCACATGACTCCCCAGAACCAGCCGCACACC CAAATCTGTGTGGGATTGACCACGAGGCGCTGAATAAGCAAATAATGGAGTACAAACGCAAGAAGGAGCG AGGGCTTCAGTGTCAGAGTCTGGCGCCACCATCAGGGCGGGAGCAGGCACCTGAACCGACCCGTCTGCTC CGGAAGAGAGAGAAGGTGCGATCCCGGTGGCAGCACCGGGACGCTTCCCCCAGAAGCTTCCTTTTGGGCG AGGAGGACGAGGACGAGGACAGCAGCACAGAGTGGGAATGCCACGCCCACGAGGCAGAGGATGATGATGA TCATCAGGAAGAGGAGCTCGGAGCTGACAGAGGCGCACAGCGGGGCCTCTGTGGCAAGAGAGAGCAGGGG TAGGGCTGGGGCCTCCGAGCTGCCGCCCCTGCCTGTGGGTCAGACTGCAGGACAGAGCCTCTGGTGTACC TTCTGTCGTAGTCACTCACGGAGGCGGCCTGACCTCAGCGGCAGGAGAACTGCACCCATCGGACTGCACC TGCAGACCTCCGCAGCCAGTCCTCAGCGATTGGTACCTACCTGGTCCCGGATAAATAAACGATTTTGTAT TTACTCTGAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
Tag Tag Free
ACCN BC064066
ORF Size 1053 bp
Insert Size 1053
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC064066,
RefSeq Size 1361
RefSeq ORF 1053
Locus ID 68731
Cytogenetics 18|18 E3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.