Ap2s1 (BC052499) Mouse Untagged Clone

CAT#: MC206717

Ap2s1 (untagged) - Mouse adaptor-related protein complex 2, sigma 1 subunit (cDNA clone MGC:62945 IMAGE:3370978), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ap2s1
• Synonyms: MGC62945
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC052499
  GGCACGAGGCACAACTGCAAGCAGAGCCGGAGCCGCCCTGTTACAGCGGGACCCGGGCCTCTGGGGTCCA GACAGGGGTCGCCATGATCCGATTCATCCTTATCCAGTGGTACATGCAGTTCGATGACGACGAGAAGCAG AAGCTGATCGAGGAGGTGCACGCCGTGGTCACCGTCAGGGATGCCAAGCACACCAACTTTGTGGAGTTCC GGAACTTCAAGATCATCTACCGACGCTACGCTGGCCTCTACTTCTGCATCTGCGTGGATGTCAACGACAA CAATCTGGCCTATCTCGAGGCCATCCACAACTTCGTAGAAGTGTTAAATGAATACTTCCACAATGTCTGT GAACTGGACCTGGTGTTCAACTTCTACAAGGTTTACACGGTGGTAGATGAGATGTTCCTGGCAGGAGAGA TCCGAGAGACCAGCCAGACGAAGGTGCTGAAGCAGCTGCTGATGCTGCAGTCCCTGGAGTGAGGGGGGCT CTGCCCAGCCCGGCCTGCTGGACCAACCTGCCTGCTCGTCCCCTGCCTGCCAGGCCTGAGGCCCACCCTA GCAGCCCCTTCCCTTCCTCAGCTGGCCCAGAGGAAGGACCCGGCAGGGTCTAGGCCACAGGGGAGGAGGC CAGAACCCACTGCCTCTGGGCCCTCCGTGGATGGCAGAGGCCACCGTGATGTCCCGAGTAACTGTGCCAT TGTCGTGTGATGCTGTGAGTGTGTGTGTGTGTAGCCCCCAATAAACCTGTGGTCCTGCCTGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAA
• Restriction Sites: EcoRI-NotI
• ACCN: BC052499
• Insert Size: 399 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC052499, AAH52499
• RefSeq Size: 829 bp
• RefSeq ORF: 399 bp
• Locus ID: 232910
• Cytogenetics: 7 A2
• Gene Summary: Component of the adaptor protein complex 2 (AP-2). Adaptor protein complexes function in protein transport via Transport vesicles in different membrane traffic pathways. Adaptor protein complexes are vesicle coat components and appear to be involved in cargo selection and vesicle formation. AP-2 is involved in clathrin-dependent endocytosis in which cargo proteins are incorporated into vesicles surrounded by clathrin (clathrin-coated vesicles, CCVs) which are destined for fusion with the early endosome. The clathrin lattice serves as a mechanical scaffold but is itself unable to bind directly to membrane components. Clathrin-associated adaptor protein (AP) complexes which can bind directly to both the clathrin lattice and to the lipid and protein components of membranes are considered to be the major clathrin adaptors contributing the CCV formation. AP-2 also serves as a cargo receptor to selectively sort the membrane proteins involved in receptor-mediated endocytosis. AP-2 seems to play a role in the recycling of synaptic vesicle membranes from the presynaptic surface. AP-2 recognizes Y-X-X-[FILMV] (Y-X-X-Phi) and [ED]-X-X-X-L-[LI] endocytosis signal motifs within the cytosolic tails of transmembrane cargo molecules. AP-2 may also play a role in maintaining normal post-endocytic trafficking through the ARF6-regulated, non-clathrin pathway. The AP-2 alpha and AP-2 sigma subunits are thought to contribute to the recognition of the [ED]-X-X-X-L-[LI] motif. May also play a role in extracellular calcium homeostasis (By similarity).[UniProtKB/Swiss-Prot Function]