Itgb1bp1 (BC028772) Mouse Untagged Clone
CAT#: MC206543
Itgb1bp1 (untagged) - Mouse integrin beta 1 binding protein 1 (cDNA clone MGC:41376 IMAGE:1230640), (10ug)
"BC028772" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Itgb1bp1 |
Synonyms | AI449260; AU019480; Icap1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028772
CTTCTCTGGATCGAGCTATGGTGAAAGATGTTTCGCAAAGGCAAGAAGAGACACAGCAGCAGCAGTTCCC AGAGCAGTGAAATCAGTACAAAGAGCAAGTCTGTGGATTCCAGCCTTGGAGGACTTTCAAGATCCAGCAC TGTCGCCAGCCTCGATACAGACTCCACTAAAAGCTCAGGACAGAGTAACAGCAATTTAGACACATGTGCT GAGTTCCGAATAAAGTATGTTGGTGCCATCGAGAAACTGGCCGTGTCTGAGGGGAAGAGCCTTGAAGGAC CACTAGACCTGATAAATTACATAGATGTCGCCCAGCAAGATGGAAAGTTGCCTTTTGTGCCTTTGGAAGA GGAGTTCATTCTGGGCGTTTCTAAGTACGGCATAAAAGTCTCGACCACGGATCAGCATGGTGTTCTGCAT AGGCATGCCCTGTATCTAATCATCCGGATGGTGTGTTACGATGACGGCCTGGGAGCTGGGAAAAGCTTGC TGGCACTCAAGACCACAGATGCAAGCAACGAAGAGTACAGCCTGTGGGTTTACCAGTGTAACAGCCTGGA GCAAGCCCAAGCAATCTGCAAGGTCTTATCCACAGCATTTGACTCTGTGTTGACCTCTGACAAGTCCTGA ACTCTGCAGGCAAGTGGAAACTGACCCACGGAGCTTACCTGTTCCTACATCTATCTGCAGCTGTGGACTA TTAGAGGGTGTAATGCCCTGACCCGGTTTTCTAAAGTGTAATGTATGAAATATTGGTTTTATACTAAAAG GTGTTAACAGTAGGTCAACTTCCAATAAATTACCTGCTTTCTGGAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | BC028772 |
Insert Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC028772, AAH28772 |
RefSeq Size | 837 bp |
RefSeq ORF | 603 bp |
Locus ID | 16413 |
Cytogenetics | 12 A1.3 |
Gene Summary | Key regulator of the integrin-mediated cell-matrix interaction signaling by binding to the ITGB1 cytoplasmic tail and preventing the activation of integrin alpha-5/beta-1 (heterodimer of ITGA5 and ITGB1) by talin or FERMT1. Plays a role in cell proliferation, differentiation, spreading, adhesion and migration in the context of mineralization and bone development and angiogenesis. Stimulates cellular proliferation in a fibronectin-dependent manner. Involved in the regulation of beta-1 integrin-containing focal adhesion (FA) site dynamics by controlling its assembly rate during cell adhesion; inhibits beta-1 integrin clustering within FA by directly competing with talin TLN1, and hence stimulates osteoblast spreading and migration in a fibronectin-and/or collagen-dependent manner. Acts as a guanine nucleotide dissociation inhibitor (GDI) by regulating Rho family GTPases during integrin-mediated cell matrix adhesion; reduces the level of active GTP-bound form of both CDC42 and RAC1 GTPases upon cell adhesion to fibronectin. Stimulates the release of active CDC42 from the membranes to maintain it in an inactive cytoplasmic pool. Participates in the translocation of the Rho-associated protein kinase ROCK1 to membrane ruffles at cell leading edges of the cell membrane, leading to an increase of myoblast cell migration on laminin. Plays a role in bone mineralization at a late stage of osteoblast differentiation; modulates the dynamic formation of focal adhesions into fibrillar adhesions, which are adhesive structures responsible for fibronectin deposition and fibrillogenesis. Plays a role in blood vessel development; acts as a negative regulator of angiogenesis by attenuating endothelial cell proliferation and migration, lumen formation and sprouting angiogenesis by promoting AKT phosphorylation and inhibiting ERK1/2 phosphorylation through activation of the Notch signaling pathway. Promotes transcriptional activity of the MYC promoter.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202029 | Itgb1bp1 (tGFP-tagged) - Mouse integrin beta 1 binding protein 1 (cDNA clone MGC:41376 IMAGE:1230640) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review