2900092E17Rik (BC003932) Mouse Untagged Clone

CAT#: MC206452

2900092E17Rik (untagged) - Mouse RIKEN cDNA 2900092E17 gene (cDNA clone MGC:7316 IMAGE:3485982), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: 2900092E17Rik
• Synonyms: 2900092E17Rik; C77040; PA1; PAGR1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC003932, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCCTTGCCCTGGGCCATGGAACCATTGCAGGCAGCACAGCAGCGCCTCTGTCTGAAGAAGGGGAAG
  TGACTTCCGGCCTCCAAGCTCTGGCGGTGGAGGACACTGGAGGTCCCTCTGTCTCGGCTAGTAAGGCCGA
  GGAAGAGGGGAAAGGCAGTCAGGAGGAGGCCGGGCGTGAGGGATCCAGGCCTGAGGAGGCACTAGAAGCT
  CCCAGCGCTGCGAGCGACGAGCGTGCGGAGGGAGAAGCCGAAGACTGGTGCGTGCCCTGCAGCGATGAGG
  AGGTGGAGCTGCCGGCCAATGGGCAGTCCTGGATGCCCCCACCCTCCGAGATCCAGCGGCTCTATGAACT
  GCTGGCTACCCAAGGTACTCTGGAGCTTCAAGCAGAGATCCTACCCCGCCGGCCGCCTACCCCAGAGGCC
  CAGAGTGAAGAGGAGAGATCAGACGAGGAGCCAGAGGCCAAAGAAGAGGAGGAGGAAAAGCCGCACATGC
  CTACAGAATTTGACTTTGATGATGAGCCAATGACACCAAAGGACTCACTGATTGACAGGAGACGGACACC
  AGGAAGCTCAGCCCGGAGCCAGAAACGGGAGGCGCGTCTGGATAAGGTCCTCTCAGACATGAAGCGCCAT
  AAGAAACTAGAGGAGCAAATCCTCCGGACCGGGAGAGACCTCTTCAGCTTAGACTCAGAGGGCCCCAGCC
  CCACCAGCCCTCCACTCCGATCCTCAGGAAACAGTCTCTTTCCCAGACAGCGGAAGTACTGA
  
  
• Restriction Sites: EcoRI-NotI
• ACCN: BC003932
• Insert Size: 762 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC003932, AAH03932
• RefSeq Size: 1448 bp
• RefSeq ORF: 762 bp
• Locus ID: 67278
• Cytogenetics: 7 F3
• Gene Summary: Its association with the histone methyltransferase MLL2/MLL3 complex is suggesting a role in epigenetic transcriptional activation. However, in association with PAXIP1/PTIP is proposed to function at least in part independently of the MLL2/MLL3 complex. Proposed to be recruited by PAXIP1 to sites of DNA damage where the PAGR1:PAXIP1 complex is required for cell survival in response to DNA damage independently of the MLL2/MLL3 complex (PubMed:19124460). However, its function in DNA damage has been questioned (PubMed:26744420). During immunoglobulin class switching in activated B-cells is involved in transcription regulation of downstream switch regions at the immunoglobulin heavy-chain (Igh) locus independently of the MLL2/MLL3 complex (PubMed:26744420). Involved in both estrogen receptor-regulated gene transcription and estrogen-stimulated G1/S cell-cycle transition (By similarity). Acts as transcriptional cofactor for nuclear hormone receptors. Inhibits the induction properties of several steroid receptors such as NR3C1, AR and PPARG; the mechanism of inhibition appears to be gene-dependent (By similarity). May be involved in the regulation of the BMP pathway in extraembryonic development (PubMed:24633704).[UniProtKB/Swiss-Prot Function]