Pmpca (NM_173180) Mouse Untagged Clone

CAT#: MC205332

Pmpca (untagged) - Mouse peptidase (mitochondrial processing) alpha (Pmpca), nuclear gene encoding mitochondrial protein, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name Pmpca (NM_173180) Mouse Untagged Clone
Symbol Pmpca
Synonyms 1200002L24Rik; 4933435E07Rik; Alpha-MPP; P-55
Vector pCMV6-Kan/Neo
Sequence Data
>BC010810
CGATGGCGACGGCAGTGTGGGCGGCTGCGCGGCTGCTTCGGGGATCTGCGGTGCTGTGCGCGCGGCCCAG GTTTGGATCTCCTGCACACAGACGGTTCAGCAGTGGTGCCACCTACCCCAACATCCCCCTCTCTTCTCCC TTGCCTGGAGTACCCAAGCCTATTTTTGCAACAGTTGATGGACAGGAAAAGTTTGAAACCAAAGTTACCA CTCTGGACAATGGGCTTCGTGTGGCATCTCAAAATAAGTTTGGACAATTCTGTACCGTAGGAATTCTTAT TAATTCAGGATCACGATATGAAGCGAAATATCTTAGTGGAATAGCTCATTTTTTGGAAAAATTGGCATTT TCGTCCACTGCTCGATTTGACAGCAAAGACGAAATCCTGCTTACGCTGGAAAAACATGGTGGTATCTGTG ACTGCCAGACCTCAAGAGACACCACCATGTATGCTGTGTCTGCTGACAGCAAAGGCTTGGACACTGTGGT GGATCTGTTGGCTGATGTGGTTCTGCACCCCCGACTGACAGATGAAGAAATTGAGATGACGAGGATGGCT GTGCAGTTTGAACTAGAGGACCTGAACATGAGACCTGACCCAGAGCCACTGCTCACCGAGATGATTCATG AAGCTGCTTTTAGGGAGAACACAGTGGGTCTGCACCGGTTCTGCCCTGTAGAGAACATAGCGAAGATCGA TCGGGAAGTGCTGCACTCCTACCTAAAGAACTACTACACCCCTGACCGCATGGTGCTTGCTGGGGTGGGC GTGGAGCATGAGCACCTAGTAGAATGTGCCAGAAAGTACCTCGTGGGAGCCGAGCCTGCCTGGGGAGCCC CTGGAACGGTGGACGTTGACAGATCAGTGGCACAGTACACTGGGGGGATCATCAAGGTGGAAAGAGACAT GTCAAATGTCAGCCTTGGCCCAACCCCAATTCCAGAGCTCACACACATCATGGTGGGACTGGAGAGCTGT TCCTTCCTGGAGGACGACTTCATCCCCTTTGCTGTGCTGAATATGATGATGGGAGGAGGGGGCTCCTTCT CAGCTGGAGGGCCTGGCAAAGGCATGTTCTCCAGGCTCTACCTCAATGTGCTCAATCGGCACCACTGGAT GTACAATGCAACCTCCTACCACCACAGCTATGAAGATACAGGCCTCCTGTGCATTCATGCCAGCGCAGAC CCAAGACAAGTTCGAGAAATGGTAGAAATCATCACAAAGGAGTTTATCTTGATGGGCAGGACGGTGGATT TGGTGGAGCTAGAGCGGGCCAAGACACAGCTCATGTCCATGCTCATGATGAACCTGGAGTCCAGGCCTGT GATTTTTGAGGATGTGGGGAGGCAGGTGTTGGCTACACATTCAAGAAAGCTGCCCCACGAGCTATGTACA CTCATTCGCAACGTGAAGCCAGAAGATATCAAGAGGGTTGCTTCCAAGATGCTCCGTGGCAAGCCTGCTG TGGCTGCCCTGGGTGATTTGACTGACCTACCCACCTATGAGCACATCCAGGCAGCGCTGTCCAGCAGAAA TGGACACCTGCCCAGATCATACCGGCTGTTCCGGTAGAGTCCCTTAGAGCTGGCTGTAGAGTGCTTGTGT GCATGTTACTGTTGGTGTAGACACTGCATAAGGCTAGCTAGCTGTGTGAACAGTGCCAACAGTGAAACTC TGGAAACTTGAATGAAAGTTACTGTTGCCACTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_173180
ORF Size 1575 bp
Insert Size 1575
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC010810, NP_775272
RefSeq Size 1759
RefSeq ORF 1575
Locus ID 66865
Cytogenetics 2|2 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)