Armc12 (NM_026290) Mouse Untagged Clone

CAT#: MC205142

Armc12 (untagged) - Mouse RIKEN cDNA 4930511I11 gene (4930511I11Rik), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Armc12 (NM_026290) Mouse Untagged Clone
Symbol Armc12
Synonyms 4930511I11Rik; AV041658
Vector pCMV6-Kan/Neo
Sequence Data
>BC049559
GCCACAAGGCAGCACGGAAGACATGGGCAAGACCATTCCCCGGTTCCTGGAGCAACTGGACCTCATCAAA AGCTTCGTGGGCCTGGCTACAGGCGCCGGGGCCTTATACCTGCTGTACAAGGCCGTCAGGACTGGCTTAA AATGTCATCCGCCACTCTGCTCCAACTCGCCGATCTGCATTGCCCGCCTGGCCATCGAGAGAGAGCGCCA CGGGCGGGACTCCGGTGAGATTCGAAGACTTCTCAACTCTCTAGACTGCAAACAGGATGAGTATACCAGG AGCATGATCCTTCATAACATCACCCGCTGCGTGTACTTGCTGGAGGCTGAGGCCTCTTCTTGTACTATGG ATGACATCGACTTGGTGGCTGACATGCTAGATGAGAAGGACAACAGTGTAAAAATCCAAGCTCTGAATGC ACTTAAAGCTTTCTCTGGCATCAGGAAATTCAGGCTCAAAATCCAGGAGCATTGCATCAAGGTACTGGAA CTGATTTCCACCATCTGGGACTTGGAATTGCACGTAGCTGGTCTCCGATTGCTCAACAACCTCCCGCTAC CTGACTATGTGCACCCACAGCTGCGGCGGGTGATGCCTGCCCTGATGGAGATCATACAGTCAGACTGCAT CCTGGCACAGGTACAAGCTGTCCGCCTCCTGAGTTACCTGGCACAGAAGAACGACCTTCTTTATGACATT CTCAACTGTCAGGTGCGTCCCAACTTCCTGAACCTCTTCCAGTCTTCACAGCCGGGCAGTCTGCTGTTCG AGGTGCTGGTGTTTGCGGAACACTTGAGTGAAGGTCGGAACGCCACCCACTACCGAGCGGTCAAATGGCA TTACAACGAACAATCCCTGCACGAAGCCCTCTTTGGGGATGAGTCCAGACTGGCAGACCGACTGCTCTCC CTGGTCATCCACCCTGAGGAGGAAGTTCAGATCCAGGCCTGCAAAGTCATAGTGAGCTTGCAGTGTCCCC AGGACCTGGGATCCCGACCCTCTTCCTGCCGACCTAGCCATTCCTGCTTTAAAACCGGGAAGTGAAGTTA AGGAGATCCAATAAATGCGTACGGGAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
Tag Tag Free
ACCN NM_026290
ORF Size 1023 bp
Insert Size 1023
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC049559, NP_080566
RefSeq Size 1174
RefSeq ORF 1023
Locus ID 67645
Cytogenetics 17|17 A3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.