Mrpl13 (NM_026759) Mouse Untagged Clone

CAT#: MC205004

Mrpl13 (untagged) - Mouse mitochondrial ribosomal protein L13 (Mrpl13), nuclear gene encoding mitochondrial protein, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Mrpl13 (NM_026759) Mouse Untagged Clone
Symbol Mrpl13
Synonyms 1110002D09Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC060968
GGTGCAAAGTAAAGGACGCCGCGGGTCGGAGAGCATGTCCAGCTTCTCTAGGGCGCCCCAGCAATGGGCC ACTTTTGCTCGAATGTGGTATCTCTTAGATGGCAAAATGCAGCCCCCTGGCAAACTTGCGGTTATAGCAT CCAACAAACTGCAAGGATTAAATAAACCAGTGTACCATCAGCTGAGTGACTGTGGAGACCACGTTGTCAT AATAAACACAAGACATATTGCATTTTCTGGAAACAAATGGGAACAAAAAGTGTACTCCTCACATACTGGC TACCCAGGCGGCTTTAGACAAGTAACAGCTGCGCAGCTTCACCGGAAAGACCCCGTGGCGATTGTGAAAT TGGCTATTTATGGCATGCTGCCCAAAAACCTGCACAGAAGGACAATGATGCAAAGGCTGCATCTTTTCCC AGACGAGGATATTCCGGAAGATATTCTTAAGAATTTAGTGGAAGAGCTTCCTCAGCCACGGAGAGTGCCT AAACGGCTGGACGAGTACACCCAAGAAGAAATAGAGGCTTTCCCCAGAGTGTGGACTCCACCTGATGATT TTCGGATGTAGGAGAATGGAAATGATAGAACATTACAGCAAGAGACTGAATGTTTCCTGAAGTATTACCA TGACCCAAGGCAGAGAGAAACCATGGGAACTCCCTGTGGGGAACACTCAAGAAGGCCAAGCCTCAGCAGG AAAGTGCAGTAGAAGATACTGTTTTACAGACAAGTCCTGTGTAACCTGCTTTAAATGCTACACATGTTAA TAAAATGCTTATTTGGTTAGCTAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
Tag Tag Free
ACCN NM_026759
ORF Size 537 bp
Insert Size 537
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC060968, NP_081035
RefSeq Size 826
RefSeq ORF 537
Locus ID 68537
Cytogenetics 15|15 D1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.