Casp4 (NM_007609) Mouse Untagged Clone

CAT#: MC205003

Casp4 (untagged) - Mouse caspase 4, apoptosis-related cysteine peptidase (Casp4), (10ug)


  "NM_007609" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Caspase-11 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Casp4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Casp4
Synonyms Cas; CASP-4; CASP-11; Casp11; Caspa; Caspl; ich-; ich-3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC061255
ACTCTGTCAAGCTGTCTTCACGGTGCGAAAGAACTGAGGCTTTTTCTCATGGCTGAAAACAAACACCCTG ACAAACCACTTAAGGTGTTGGAACAGCTGGGCAAAGAAGTCCTTACGGAGTACCTAGAAAAATTAGTACA AAGCAATGTACTGAAATTAAAGGAGGAAGATAAACAAAAATTTAACAATGCTGAACGCAGTGACAAGCGT TGGGTTTTTGTAGATGCCATGAAAAAGAAACACAGCAAAGTAGGTGAAATGCTTCTCCAGACATTCTTCA GTGTGGACCCAGGCAGCCACCATGGTGAAGCTAATCTGGAAATGGAGGAACCAGAAGAATCATTGAACAC TCTCAAGCTTTGTTCCCCTGAAGAGTTCACAAGGCTTTGCAGAGAAAAGACACAAGAAATTTACCCAATA AAGAAGGCCAATGGCCGTACACGAAAGGCTCTTATCATATGCAATACAGAGTTCAAACATCTCTCACTGA GGTATGGGGCTAACTTTGACATCATTGGTATGAAAGGCCTTCTTGAAGACTTAGGCTACGATGTGGTGGT GAAAGAGGAGCTTACAGCAGAGGGCATGGAGTCAGAGATGAAAGACTTTGCTGCACTCTCAGAACACCAG ACATCAGACAGCACATTCCTGGTGCTAATGTCTCATGGCACACTGCATGGCATTTGTGGAACAATGCACA GTGAAAAAACTCCAGATGTGCTACAGTATGATACCATCTATCAGATATTCAACAATTGCCACTGTCCAGG TCTACGAGACAAACCCAAAGTCATCATTGTGCAGGCCTGCAGAGGTGGGAACTCTGGAGAAATGTGGATC AGAGAGTCTTCAAAACCCCAGTTGTGCAGAGGTGTAGATCTACCTAGGAATATGGAAGCTGATGCTGTCA AGCTGAGCCACGTGGAGAAGGACTTCATTGCCTTCTACTCTACAACCCCACATCACTTGTCCTACCGAGA CAAAACAGGAGGCTCTTACTTCATCACTAGACTCATTTCCTGCTTCCGGAAACATGCTTGCTCTTGTCAT CTCTTTGATATATTCCTGAAGGTGCAACAATCATTTGAAAAGGCAAGTATTCATTCCCAGATGCCCACCA TTGATCGGGCAACCTTGACGAGATATTTCTACCTCTTTCCTGGCAACTGAGAACAAAGCAACAAGCAACT GAATCTCATTTCTTCAGCTTGAAGAAGTGATCTTGGCCAAGGATCACATTCTATTCCTGAAATTCCAGAA CTAGTGAAATTAAGGAAAGAATACTTATGAATTCAAGACCAGCCTAAGCAACACAGTGGGATTCTGTTCC ATAGACAAGCAAACAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_007609
Insert Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC061255, AAH61255
RefSeq Size 1378 bp
RefSeq ORF 1122 bp
Locus ID 12363
UniProt ID P70343
Cytogenetics 9 2.46 cM
Gene Summary This gene encodes a member of the cysteine proteases that plays important roles in apoptosis, cell migration and the inflammatory response. The encoded protein mediates production of pro-inflammatory cytokines by macrophages upon bacterial infection. Mice lacking the encoded protein are resistant to endotoxic shock induced by lipopolysaccharide. A 5-bp deletion encompassing a splice acceptor junction resulting in alternate splicing and a shorter non-functional isoform in certain mouse strains has been described. Although its official nomenclature is "caspase 4, apoptosis-related cysteine peptidase", this gene and its encoded protein have historically been called caspase 11. This gene is present in a cluster of three caspase genes on chromosome 9. [provided by RefSeq, Apr 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.