Bbs5 (NM_028284) Mouse Untagged Clone

CAT#: MC204919

Bbs5 (untagged) - Mouse Bardet-Biedl syndrome 5 (human) (Bbs5), (10ug)


  "NM_028284" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Bbs5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bbs5
Synonyms 1700049I01Rik; 2700023J09Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC061031
GGATTTCATCGGCGAGCTCCCTCGGTCACCATGTCTGTGCTGGACGTGTTGTGGGAGGACCGCGACGTGC GCTTCGACGTGTCCTCGCAACAGATGAAAACAAGACCCGGGGAAGTCCTCATTGACTGTTTAGATTCCAT TGAAGACACAAAAGGAAACAATGGAGACAGAGGTAGACTCTTAGTCACAAACTTAAGGATCATCTGGCAT TCCTTGGCATTGCCCAGAGTCAATCTTTCTATTGGTTACAACTGCATATTGAATATCACAACAAGAACTG CTAACTCTAAACTGCGAGGCCAAACCGAAGCTCTTTATATATTGACAAAATGCAACACTACCCGGTTTGA GTTTATATTCACAAACCTGGTTCCCGGGAGCCCCAGACTTTTTACTTCTGTGATCGCAGTGCACAGAGCA TATGAAACTTCTAAAATGTACCGTGACTTTAAGTTGAGAAGTGCAGTCATTCAGAACAAGCAGCTGAGGT TACTACCACAGGAGCATGTGTATGATAAGATCAATGGCGTATGGAATCTGTCCAGCGACCAGGGGAATTT AGGAACTTTTTTTATTACCAATGTGAGAATTGTGTGGCATGCCAATATGAATGACAGTTTTAATGTCAGC ATACCATATCTGCAAATTCGTTCAATAAAGATCAGAGATTCAAAATTTGGTTTGGCGCTTGTCATAGAAA GCTCTCAGCAGAGTGGAGGATACGTCCTTGGCTTTAAAATAGACCCTGTGGAAAAACTACAGGAATCAGT TAAAGAGATCAACTCACTTCACAAAGTCTATTCTGCCAGTCCAATATTTGGAGTGAATTATGAAATGGAA GAAAAGCCACAGCCACTTGAAGCTCTGACTGTTGAACAAATTCAAGATGATGTGGAAATAGACTCTGATG ACCACACGGATGCTTTTGTGGCGTATTTTGCTGATGGGAATAAGCAACAAGATCGTGAACCTGTATTTTC AGAAGAACTGGGGCTTGCAATAGAGAAACTGAAGGATGGATTCACACTGCAGGGACTTTGGGAAGTGATG AGTTGATCTTGAGTTGTTGGATTCACACTGCAGGGACTTTGGGATGAGTTAATCTTGAATGAGTTGAGCT GGACCTCTATTTAAAGATATCTCAAGATTAAAAGATACTGCTTGCCTGCTAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_028284
Insert Size 1026 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC061031, AAH61031
RefSeq Size 1287 bp
RefSeq ORF 1026 bp
Locus ID 72569
UniProt ID Q9CZQ9
Cytogenetics 2 C2
Gene Summary The BBSome complex is thought to function as a coat complex required for sorting of specific membrane proteins to the primary cilia. The BBSome complex is required for ciliogenesis but is dispensable for centriolar satellite function. This ciliogenic function is mediated in part by the Rab8 GDP/GTP exchange factor, which localizes to the basal body and contacts the BBSome. Rab8(GTP) enters the primary cilium and promotes extension of the ciliary membrane. Firstly the BBSome associates with the ciliary membrane and binds to RAB3IP/Rabin8, the guanosyl exchange factor (GEF) for Rab8 and then the Rab8-GTP localizes to the cilium and promotes docking and fusion of carrier vesicles to the base of the ciliary membrane. The BBSome complex, together with the LTZL1, controls SMO ciliary trafficking and contributes to the sonic hedgehog (SHH) pathway regulation. Required for BBSome complex ciliary localization but not for the proper complex assembly (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.