Ethe1 (NM_023154) Mouse Untagged Clone

CAT#: MC204811

Ethe1 (untagged) - Mouse ethylmalonic encephalopathy 1 (Ethe1), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_023154" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ethe1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ethe1
Synonyms 0610025L15Rik; Hsco
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC083162
GCGATGGCGAGCGCGGTCGTCAGGGTCGCCGGGCGGCGGCTGAGCCAGCAAAGCGCATCCGGAGCCCCGG TCCTCCTGCGGCAGATGTTTGAACCCAAGAGCTGCACCTATACCTACCTTCTGGGTGACCGGGAGTCAAG AGAGGCAGTTCTGATCGACCCCGTTCTGGAGACAGCGCATCGGGATGCTCAGTTGATTAAGGAGCTGGGG CTCAAGCTGTTGTACGCTGTGAACACTCACTGCCATGCTGACCACATCACCGGCACGGGGGTTCTCCGGT CCCTGCTCCCGGGCTGCCAGTCTGTCATCTCCCGCCTCAGCGGAGCCCAGGCTGATTTGCATATCGGGGA AGGTGATTCCATCCGCTTTGGACGCTTTGCTTTGGAGACTCGAGCCAGCCCTGGCCACACTCCAGGCTGT GTCACCTTTGTCCTGAACGACCAGAGCATGGCCTTCACTGGAGATGCCCTGCTGATCCGAGGGTGTGGAC GGACAGACTTCCAACAAGGCTGTGCTAAGACTTTGTACCACTCTGTGCACGAGAAGATCTTCACACTTCC AGGCAACTGTCTAATCTACCCGGCTCACGATTACCACGGGCTCACAGTTTCTACTGTGGAGGAGGAACGG ACTCTGAACCCACGGCTTACCCTCAGCTGTGAGGAATTTATCAAGGTCATGGACAACCTGAACTTGCCCA AGCCACAGCAGATAGACATTGCTGTTCCTGCAAATATGCGCTGTGGGGTCCAGACTCCACCCTCCTGATT CGTCCCAGCCAGCTGCTCACATCCGTTATGAATGCACTAGGAGGGGTGAGGGGAGGGGTGTCACCCCAGG GCCTCTCTCTTCTCCTACCTCTACTCTCACCAGCTACTTGAGCTTCTTAAATAAAGTTTACTTCGTTTTT GCCACGAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_023154
Insert Size 765 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC083162, AAH83162
RefSeq Size 936 bp
RefSeq ORF 765 bp
Locus ID 66071
UniProt ID Q9DCM0
Cytogenetics 7 A3
Gene Summary First described as a protein that can shuttle between the nucleus and the cytoplasm and suppress p53-induced apoptosis by sequestering the transcription factor RELA/NFKB3 in the cytoplasm and preventing its accumulation in the nucleus (By similarity). Sulfur dioxygenase that plays an essential role in hydrogen sulfide catabolism in the mitochondrial matrix. Hydrogen sulfide (H(2)S) is first oxidized by SQRDL, giving rise to cysteine persulfide residues. ETHE1 consumes molecular oxygen to catalyze the oxidation of the persulfide, once it has been transferred to a thiophilic acceptor, such as glutathione (R-SSH). Plays an important role in metabolic homeostasis in mitochondria by metabolizing hydrogen sulfide and preventing the accumulation of supraphysiological H(2)S levels that have toxic effects, due to the inhibition of cytochrome c oxidase.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.