Ift27 (NM_025931) Mouse Untagged Clone

CAT#: MC203941

Ift27 (untagged) - Mouse intraflagellar transport 27 homolog (Chlamydomonas) (Ift27), (10ug)


  "NM_025931" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ift27"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ift27
Synonyms 2600013G09Rik; Rabl4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC017514
GAAGGCGGGTTGATGATGGTTGCCAGGAGCCTGTTTGGCGCGACTCTTGGGACCAGAGGACTAGTGGTTG TGTCTCAACTCTTCTTTGGGCCGGGTCTAAGGCTGGACTTGGAACGGGTTCTGCTCCGCCCCACCGGAAC CTTTGCAGGCTGCCTGGGGCCTGAAGCCCTCCGTCCACCCAACCCTAGCACCCGGGCCATCATCCATCCC TCCATCACGGCCTCAGGCCCTGGTGTCAGCTGTCCCCGAATCCTAACCCCCTTTCAGCGTCCCCCACCCC CACGTCTCCGCTAGTACCTGGTTACTATGGTGAAGCTAGCTGCCAAATGCATCCTGGCAGGGGACCCAGC CGTAGGCAAGACGGCCCTGGTGCAGATGTTCCGCAGCGACGGGACCCATTTCCAGAAGAACTACACCCTG ACAACTGGAGTGGATTTGGTGGTGAAGACAGTGCCAGTTCTTGACACAAATGACAGTGTGGAACTCTTCA TTTTTGACTCAGCCGGCAAGGAGCTGTTCTCTGAAATGCTGGATAAGTTGTGGGAGAATCCCAACGTCCT GTGCCTTGTCTATGATGTGACCAATGAACAGTCCTTCATCAGCTGCACCAAGTGGTTGGAGAAGGTCCGG TCTCAGACTTCAGGCATCTCCCTCCCAGGTGTTTTAGTGGGAACTAAGACAGACCTGGCTGGCCGACAAA CAGTGGATTCAGCTCAGGCCCAGGTATGGGCACTGAGTCAAGGCCTGGAATTCTTTGAGACATCTGTGAA GGAGATGGATAATTACGAGGCCCCGTTCCACTGTCTGGCCAAGCAGTTCTACCAGCTGTACCGGGAAAAA GTGGACATATTCCATACCCTGGTGTGAGGGTACAGTGGACTGTCCTGAAGGGCTGCCCACTCTGCCGCTG CTGCTGTGAGCCCAGCAGACCATTGTCTTTTCAGGAGACAGAAGACGGGATCACCTGGGATTTCTCAGTA TCCACCATGGTTTTCAATAAAATGAGAAGAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025931
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC017514, AAH17514
RefSeq Size 1050 bp
RefSeq ORF 561 bp
Locus ID 67042
UniProt ID Q9D0P8
Cytogenetics 15 E1
Gene Summary Small GTPase-like component of the intraflagellar transport (IFT) complex B that promotes the exit of the BBSome complex from cilia via its interaction with ARL6 (PubMed:25446516). Not involved in entry of the BBSome complex into cilium. Prevents aggregation of GTP-free ARL6. Required for hedgehog signaling (PubMed:25446516). Forms a subcomplex within the IFT complex B with IFT25 (By similarity). Its role in intraflagellar transport is mainly seen in tissues rich in ciliated cells such as kidney and testis. Essential for male fertility, spermiogenesis and sperm flagella formation (PubMed:28964737). Plays a role in the early development of the kidney (PubMed:29626631). May be involved in the regulation of ureteric bud initiation (PubMed:29626631).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.