Ranbp3l (NM_198024) Mouse Untagged Clone

CAT#: MC203469

Ranbp3l (untagged) - Mouse RAN binding protein 3-like (Ranbp3l), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ranbp3l (NM_198024) Mouse Untagged Clone
Symbol Ranbp3l
Synonyms C130037N17Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC058706
TTTTGAACATTCTAAAAGGGGAAAGGTCCAGGGCGCTTTAAAATAAACTAAGAGTTAAGTCGTGTTTCCA GCCAAATAAGCTGGCATCTTTGTAGGCAGGAGGTGCGATACTGGTAAATATTTACTGCAGAATTCTTGAC CAGTAGAAACCCTGGCATGCTTTTCGAGGAGTAAATGTTTTACATGCGAGGCGAGATCTGCGCGTGCCTC TGTGTTCTTTCCAAGTAACTTCTGAAGACAGTTTTTGATGTCTGGCTAAGACAAACTGCGCTAGTGGTCC CCGAGTCACAGCCAGATCGTTGGTACCATGTCTACAACACAAAGGAAAGACGACAGCCACCTGTTCACCA GTTCGTGCACGCGTCAGCTGCAGGTGCAGGAGGATCGGCAACAGCAAGAAAAATATGTCATTGCTCAGCC AATATTTGTTTTTGAGAAAGGAGAACACAATTTTAAGAGACCTGCAGAAGACAGCCTGGAAGAAACGGCA GAGCCTGAATTCACTGGTTTCTTGAGAAAGCGTGTAAGGTCTTCATCTGTTACGCTTCATACTACAGATC CTCAGTCTCAAGGAGTGGCAACTTTGTCTCAAACGCGTCTGAGGTCCTCGTCATTCACTGATGTCCCGAC CTTCCCTCCATGCAGGCCAGTGAGGAAAAACAATGTTTTTATGACATCACGTCTGCTGCAAAGGAGTGAT GACATGAACAACGTAGAGCAAGGACCCCCCATGAGATCTTCTGAACAGGTTCTAAGACCCGCTGTTCTGC AGCCGTCTCAAACTCAGAGTTGTCAGAAAGCAGGCACAACATTTGGGCCCGGTGCATTGAAATCCTACAA AACTAAGGAAAAGGCCGAGCACGAGATTTCTGAAGTTGGAAGTTCCTCTAGTTTACTAAGTGAAAATTTA CCAAATGCCAGAAGCTCAATCCAGCTGTCTACTGATCCATGCATCTCAGAGGCACCATCGGGATGCCAAC CAAAGGAAGATAAGTGTTCTTTTACAAGCTGCAGTTCTGACTTCGTTTTTGGAGAAAACATGGTAGAAAG AGTTTTGGGCACTCAAAAACTTACTCAGCCTCCACTTCAAAATCTTTCATATGCCAAGGAAAAAACATTC AAATCTGTTCTGAAATTCCCTAATGCTGTTTCAAATTCAGACTCTATTGAAAACATATCCCTAGTCGAAT CAGCTGCTGCTTTTTCCTCCAAACCATCACAAAAATGCTTGCTTGAGAAGATTGATGTTATAACAGGAGA AGAAACTGAACATAATGTGTTAAAGATCAACTGCAAGATCTTTGTATTCAACAAAGCCACAGAATCCTGG AGTGAAAGAGGCCAAGGGATTTTGCGACTGAACGACACGGCCGGCCGAGAGTGTGGAACACTGCAGTCAA GACTAATCATGCGCAACCAAGGCAGTCTGAGGCTGGTCCTCAACAGCAGACTCTGGGCTCAGATGAAGAT TCAAAGAGCAAGTCAGAAAAATTTGCGAATAACTGCGACTGATTTAGAAGACGATGGTATAAAAATATTT TTAATTCAGGCTAGTGCCAAAGATACAGGCTTTCTGTATGCAGCAATCCACCACCGTCTGGTCGCGCTTC GAAGCCTCGCTAAGCAGGGTGACGGTGGTCCAGCCGAAAGCCAGTCCGATACAGCCCTCCCTCAGCTCAA TGGCGAGAGCTGTGACGAGGATGAGGATGAGATCGCACAAGTCACTAAAAATGGATCAGATCCTTCAAGG TGGAGCCACAGACAGTCAATTGTCTGTTCATAAACCCTCTCTGCTATAAACATGACATCTACAGAAAGAG TGGCCACTCTATTGAAAGGCAAGACCATCCTAACTGAGAAGACTCTACTCATTCATACCTTAAAGAGTTT TTTTAATTAAAGAAACAAACACAATTTATTGTAATTAAAAGTTTTAAGTTTTCATTATTGTGGACAGAAT TTAAGAAATGGCCTTCAGAATTTATCCTTTTGTGGATTACTCTAGAATAAGATTTGATAACTAATTTGGT CTATTCATTACACTGACAGATATATTAATTAAAAGTACAAATTGTCATCTTTGATAAATCTTTGATACAT ACCTAAAGTATTTATTTTAAGTCACATATTGTCTGGCTATAAAATATAGAATATAGAATATATAGAATAT AGAATATTTTACTAAATTTACAGTAATCTCTTTGGAAAATACCATAACTGCAAGGCATTTTATTAAACCA TGTGTATATTCTGAGAAATTTGTATTTTCACTTACACTTTGAATTTCCTAATACACACAAGAATTCTTTT ACAAGAGTGCCCATTCATGGACTTTTATCCATTGCATCTTATGTATTTGACTCAAAGTCAGCTCACAAGA GTTGATGAATAATTGAACAAAATGTATTACCTATGTGTCAAAAAATGTACAGAAACCAAATATCAATGTG CTTTATTTAGGTGGTCGTCTTAATAGTCTAGTAGGTGTAAGGCTATGGTAGAAGCCATTTTTTAACAAAT GTCTCCTATATATATGGGCAAATGAGTATCTCAAATTCCATCATTATGATATAGTAATTTTAATAATTGT TAGCAGATGCTTTATACCTTTTTGATATTTCAGAGACATTTTATGAATCATGCATGAAAATCCATGTCAG AATTGAGGGCAATATTTTATTTTATTAGTAGCCCCAAACAATCTCATTACAGGATAAAGATTCAAGGTCA TAAATGATTTTGGATGTGTTCTGAATCTTGATATGCTTGTAATAAGCCTGAGACTTTACAAACTGTTACA CTGAGGAAAATATTCTTTGAAAGCATACATATGAATATATATTTTAAAAGTTGACAATGCTTTATTGCCT CCATACAACAGAAGTATCCGCATGTGCCTATCTATTAATCAAATCTCAGCTTAAATCTGAAAGTCTGGCA TACAATCGCTGAGTAAGGTCTTTTAGAGTAGGATTTAATTAATATGTTCAGAAGAAGATAGAAAAGGTAT CAGAAGAAGAGAGAAAGACTTGCCATCAGGAAAAGGAGTAAACGCAGATGATTAAGATGATCTCCCCTCC CTCCCACTCTGTGGCAGAATACAAATCATAGGATGAGTCTAACAAGAAGCATCATCAGAGAGGCATTTGA AGAAGATATGAAAGTACTGCTTCACCCATAGGATGTTAGCTTTGAGGGAACATTCTGATTGTATGGTGAT TTTTAAAGTGAAGCAGAGAACAGAGGTCTTCTCTATCCCTTGGCATGTTTCTTCTTGGTCCCATACTGGA AATGAAATGAAGTAAAAAAAAAAAAATTGTGTGTTCCAAATACTTTAATAGAAGTTGAGTCGACTGATTT TCTTTGGTCTTCTGTACAGATGGCAAATGAGAAAGAGACTTACTTGTAACCCATACAGAAATGCCAGGAG GTGCCCAAGTAGGTTAGAATGTCAGCATGGCAGAGAGACAGTGTCAACCTCAGGGTCATGAAACGGTGAC AAGGAGCAGAGACATGACATACATTGCAAGAGTCCTCCATCTTTTTTTTTTTTGTTGTTGTTGTTTGTTT GTTTGTTTTGTTTTTTTTTTCGAGACAGGGTTTCTCTGTGTAGCCTTGGCTGTCCTGGAACTCACTTTGT AGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAG GTGTGTGCCACCACGCCCGGCTGAGTCCTCCATCTTGATTAGGAGAAACATTTCCTAGATTTTCTTTATC TTGTATTTTCATCTAGCCTCCTCCTGCCCCCACTTTTTGGGTCTTCTACACTCTTTGTCTCCTTTCAATG TGAAGCAATCAACTATACAATAATATTCATTTTCATAAGTTATTCAGACAGGTGAGTGCAAATCTTACAT TCTGGATTTCCATATAAGCTATTTTTTATTAAAATCTGATAAACTGATTTCCAAATTTATTACATATGTA TCTAAATTTATATTGAATTATATATCTTATATAAAGATAATCTAAATATTGTCTTTCAATAGTATTTACT CTAATTGTTTAGCATAATTGATGAATCATTAAAACATTTCCTGCTACAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_198024
ORF Size 1476 bp
Insert Size 1476
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC058706, NP_932141
RefSeq Size 4128
RefSeq ORF 1476
Locus ID 223332
Cytogenetics 15|15 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.