Siah1a (NM_009172) Mouse Untagged Clone

CAT#: MC203258

Siah1a (untagged) - Mouse seven in absentia 1A (Siah1a), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Siah1a
• Synonyms: AA982064; AI853500; Sinh1a
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC046317
  CCGGGCTGCCGGGCGGGCGCGCTCTCGAGGGCGGCGGCCCAGGGTGTCCCGTCGGTCTCGGTGCCGGGAG AGGTGGAGGCGCGGCCCGCGGTGGCGGCGGTGACGGTGGCGGTGGCGGTGGCGGCGGCGGCAGCTGGCGA CCGGGCGCGTTAGACGGGGCCGGGGTCCGCGGCGCGCTCTCCGCCCACAGAGATGAGCCGCCAGACTGCT ACAGCATTACCCACTGGCACCTCAAAGTGTCCACCATCCCAGAGGGTACCTGCCTTGACCGGCACAACTG CATCCAACAATGACTTGGCGAGTCTTTTTGAGTGTCCTGTCTGCTTTGACTATGTGTTGCCACCTATTCT TCAGTGTCAGAGTGGCCATCTTGTTTGTAGCAACTGTCGCCCCAAACTTACATGTTGTCCCACTTGCCGG GGCCCATTGGGATCCATTCGCAACTTGGCTATGGAGAAAGTGGCCAACTCAGTACTCTTCCCTTGTAAAT ATGCCTCTTCTGGATGTGAAATAACTCTGCCACACACCGAAAAGGCAGAGCACGAGGAGCTCTGTGAGTT CAGGCCTTACTCCTGCCCCTGCCCTGGTGCTTCCTGTAAGTGGCAAGGCTCCTTGGATGCCGTCATGCCC CACCTGATGCATCAGCACAAGTCCATTACCACCCTGCAAGGAGAAGATATAGTTTTCCTTGCTACAGACA TTAACCTTCCTGGTGCTGTTGACTGGGTGATGATGCAGTCTTGTTTTGGCTTTCATTTCATGTTAGTCTT GGAGAAACAAGAAAAATATGATGGTCATCAGCAGTTCTTTGCAATTGTACAACTGATAGGAACACGCAAG CAAGCTGAAAATTTTGCATATCGACTTGAGCTAAATGGTCATAGGCGGCGATTGACTTGGGAAGCGACTC CTCGGTCTATTCATGAGGGAATTGCAACAGCCATTATGAATAGTGACTGCCTAGTGTTTGACACCAGCAT TGCACAGCTTTTTGCAGAAAATGGCAATTTAGGCATCAATGTAACTATTTCCATGTGTTGAAACGGCAAT CAAATATTTCTGGCCAGTGTTTAAAATTTGCATTTGACTTCACAGAGAATAAGGCACCCATCTGCTTGCC AACCTAAAACTTTCCTGGTAGGTAGAAGCTAGACATGAAGGTAAATAAAAAGAAAAGCTGTTAATACAGG AAACAGTTGCATGTAGTAACACTAATATATTTAAAAATAATTCAACAGTAAACCACTGAAAAAAATATAT ATACCCAAGATGGGCATCTTTTGTATTAAGAAAGGAAACATTGTAAAATATTTCTGAACTTTGTGTTTGT TGTAGATTGATTGTATTGTTGACAATTTTTTGGGGGTGTGTGTCTGTGCACGCATGCGTGCACGTGTGTG GTTGGTTTTCTTTTAACTGACAAGCCATCTGCGTGGTCATAGACCACTGTTTTCCCCTTGTGAGTCAACA CATAGTGCTGCTGTGGGTTTGTTTTTGTTTTTCTGTTTTGTTTTTGTTTTTTGATGTGTGTATTTGCTAA TTTTTATTCTAGTTTTTCATTAAATAAATTTGACTTTCTTTTCTGTAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_009172
• Insert Size: 849 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC046317, AAH46317
• RefSeq Size: 1645 bp
• RefSeq ORF: 849 bp
• Locus ID: 20437
• UniProt ID: P61092
• Cytogenetics: 8 42.1 cM
• Gene Summary: E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Mediates E3 ubiquitin ligase activity either through direct binding to substrates or by functioning as the essential RING domain subunit of larger E3 complexes. Triggers the ubiquitin-mediated degradation of many substrates, including proteins involved in transcription regulation (ELL2, MYB, POU2AF1, PML and RBBP8), a cell surface receptor (DCC), the cell-surface receptor-type tyrosine kinase FLT3, the cytoplasmic signal transduction molecules (KLF10/TIEG1 and NUMB), an antiapoptotic protein (BAG1), a microtubule motor protein (KIF22), a protein involved in synaptic vesicle function in neurons (SYP), a structural protein (CTNNB1) and SNCAIP. Confers constitutive instability to HIPK2 through proteasomal degradation. It is thereby involved in many cellular processes such as apoptosis, tumor suppression, cell cycle, axon guidance, transcription, spermatogenesis and TNF-alpha signaling. Has some overlapping function with SIAH2. Required for completion of meiosis I in males. Induces apoptosis in cooperation with PEG3. Upon nitric oxid (NO) generation that follows apoptotic stimulation, interacts with S-nitrosylated GAPDH, mediating the translocation of GAPDH to the nucleus. GAPDH acts as a stabilizer of SIAH1, facilitating the degradation of nuclear proteins.[UniProtKB/Swiss-Prot Function]