Htr3b (NM_020274) Mouse Untagged Clone

CAT#: MC203254

Htr3b (untagged) - Mouse 5-hydroxytryptamine (serotonin) receptor 3B (Htr3b), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Htr3b (NM_020274) Mouse Untagged Clone
Symbol Htr3b
Synonyms 5-HT3B
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC046990
CAAAATAGCAGCACCAAGGTTACCACACATGAGCAAACAGGAGAAGAGGGTGGAGGGGTGCTGAGAGGTG CAAGGTCAAGCAGTGTCCCCCGGCTCGCCAGCCTGCCTGCCCACCAGCCTGCCTGCCCACCAGCCGGCAG CCATCGCTCTTCTCTGGTACCTGCCCCAGAATAGGCAAGTGCGATGATTCTTCTGTGGTCCTGCCTCCTG GTGGCTGTAGTAGGTATCCTAGGTACAGCGACACCTCAGCCTGGGAATTCTTCTCTGCACCGTCTCACCA GGCAGCTCTTACAACAGTACCACAAGGAGGTCAGACCAGTTTACAACTGGGCTGAGGCCACCACTGTCTA CCTGGACCTTTGCGTCCATGCTGTATTGGATGTGGATGTGCAGAATCAAAAATTAAAGACAAGCGTGTGG TACCGAGAGGTTTGGAACGATGAGTTTTTGTCCTGGAACTCTAGTCTGTTCGATGAGATTCAAGAGATCT CTCTCCCTCTCAGTGCCCTCTGGGCCCCTGATATCATCATTAATGAGTTTGTGGATGTTGAAAGATCTCC TGACCTGCCCTATGTATACGTGAACTCTTCTGGCACCATTAGAAACCACAAGCCCATCCAGGTGGTCTCC GCATGCAGTTTGCAGACATATGCTTTCCCCTTTGATATCCAGAACTGCAGCCTCACCTTTAATAGCATTC TGCACACAGTGGAAGACATAGACCTGGGCTTCCTGAGGAATAGAGAAGACATCGAGAATGACAAAAGGGC TTTTATGAATGACAGTGAGTGGCAGCTTCTTTCTGTGTCCTCTACTTACCACATCCGGCAGAGCAGCGCT GGAGACTTCGCACAGATTCGGTTCAACGTAGTGATCCGCAGATGTCCATTGGCCTACGTTGTGAGCCTCT TGATACCTAGCATCTTCCTGATGCTCGTGGACCTGGGAAGCTTCTACTTGCCCCCCAACTGCCGTGCAAG AATTGTGTTCAAGACCAATGTGCTGGTGGGCTATACGGTCTTCAGGGTCAACATGTCTGATGAAGTGCCA AGAAGTGCAGGGTGCACACCTCTGATTGGGGTCTTCTTTACCGTCTGCATGGCCCTCTTGGTTCTCAGTT TATCCAAATCCATCTTGCTGATCAAATTCCTCTATGAGGAGCGGCACAGTGGGCAAGAACGGCCTCTTAT GTGCCTTCAAGGCGACTCTGATGCCGAGGAGTCTAGATTGTACCTCGGGGCTCCACGTGCTGACGTCACA GAGTCCCCGGTCCATCAGGAGCATCGGGTCCCATCAGATACTCTGAAGGATTTCTGGTTCCAGTTCCGGT CCATCAACAACTCTCTTCGAACTCGGGATCAGATTCACCAGAAGGAGGTGGAGTGGCTGGCCATCCTGTA TCGCTTTGATCAGCTGCTCTTCCGAATCTACCTTGCCGTGCTGGGGCTCTATACCGTCACCTTATGCTCT CTCTGGGCACTGTGGAGCAGAATGTGACAATGGAGACCGCTGGTCTCACTTGATATGGGGTTACAACATG TAGGGAAAGCTGAACAGTGCTTGGAGAGGGTCTGAAAAGAAGGGGTGGGTAGCCTCCAGGATGCTATTGT CTCTTTTCAGTGACTACAGAGACAAGTATCTTATTGGCTATTGACCAAACCAGTAAACCTACATGTTCAT AATAAAGATGTCTAAACAGAATAGAGTATGCAGTGACAAGCAAGCTTTCACTCTCCCTGAACCAGCAGCA ACTGCGTACACTTAGGTTTAAGGAAAAAAAAGTTTGCTTTTAGATTTTTGAAGCTGGGTCTCTTATAGTC CAGGCTAACCTTGAACCCCTGACATTCCAGCCTCTACCTTCCAATTGCTGAGGTTGCATGTATTGTGCCA CCATGTCCAGCTCCATTTGATATCTTCTGCTTCAACAGTCTATATGTTAGCTTGGCTTAAGCCCTGCTCA AACCTGCTTAAATCCTCCAGGTTCATCAATACATTATTGTCTCCTCAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_020274
ORF Size 1314 bp
Insert Size 1314
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC046990, NP_064670
RefSeq Size 2076
RefSeq ORF 1314
Locus ID 57014
Cytogenetics 9|9 A5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.