Washc3 (NM_026070) Mouse Untagged Clone

CAT#: MC203173

Ccdc53 (untagged) - Mouse coiled-coil domain containing 53 (Ccdc53), transcript variant 1, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Washc3 (NM_026070) Mouse Untagged Clone
Symbol Washc3
Synonyms 2900091E11Rik; 5730495F03Rik; Ccdc53
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC029256
CGGACGCGTGGGTGAGCCCCGGGGTCCCCATCCGCTGAGGAGATGGATGAGGATGGGCTTCCTCTCATGG GGTCAGGCATAGACCTGACCAAGGTGCCAGCTATTCAACAGAAAAGAACCGTGGCCTTTCTAAACCAGTT TGTGGTGCACACTGTGCAGTTTCTCAACCGGTTTTCCGCAGTTTGTGAGGAGAAACTGGCAGACCTTTCT CTCCGGATTCAGCAAATTGAAACAACTCTCAATATTTTAGATGCAAAGCTGTCATCTATCCCAGGCCTAG AGGACGTCACAGTTGAAGTGTCTCCTTTAAATGTCACTGCTGTCACAAACGGATCACATTCTGAAACCAC TTCGGAGCAAACGCAGCAGAATAGCACACAAGACTCTGGAGCACAGGAGAGTGAAGCGCCATCAGAAAAT GTCCTGACCGTAGCCAAGGATCCGCGGTATGCCAGATACCGCAAGATGGTTCAAGTGGGTGTTCCAGTGA TGGCAATCAGAGACAAGATGATCTCAGAAGGACTGGACCCGGAGCTACTGGAGAAGCCAGATGCCCCGGT GCCAAATGGCGAAAGCAAAAGAGCCGTAGAAGAAAGTTCAGATAGTGACTCTTCCTTCAGTGACTAAGGG ACTGGGGGAATCACACAGAACGTGGAAGAATGTATTTACGTTCTAGAAAAGAGCCTACGCTCTATCTAGC TCTCCGTGATAAACATCACCAAATGCTACTGCATACCTACCCCAACCTTTCTCTGTTTAAAAATAATTAT AATAATAAAGCATTTATAATCTTTCAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_026070
ORF Size 585 bp
Insert Size 585
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC029256, NP_080346
RefSeq Size 811
RefSeq ORF 585
Locus ID 67282
Cytogenetics 10|10 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.