Nat10 (NM_153126) Mouse Untagged Clone

CAT#: MC202909

Nat10 (untagged) - Mouse N-acetyltransferase 10 (Nat10), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name Nat10 (NM_153126) Mouse Untagged Clone
Symbol Nat10
Synonyms AI429152
Vector pCMV6-Kan/Neo
Sequence Data
>BC034516 sequence for NM_153126
CATAGCTGTAGTGGTCCCCTCCCTTCTGAGCACTTGCCCACGTGCTGTCTGCCACTTAAGCGGATTCACG TGCAGCGGCGGCCCCGGCGTGGCTCAGCTGTGTAGAATTTTCTCCAGCAGATTGGTCAGCCTGGGTAGCA ACTCGGTGTCTTCACGTGCTTCCGTTGTGCAGCTGCCTGGTGTCGGCCGGAGCAGGGCGCAGTGATAGCT TTTCATCATGAATCGGAAGAAGGTGGATAACCGAATTCGAATTCTCATTGAGAATGGCGTAGCTGAGCGG CAGAGGTCTCTTTTTGTTGTAGTTGGGGATCGAGGAAAAGATCAGGTGGTTATTCTTCATCATATGTTGT CCAAGGCAACTGTGAAGGCTCGGCCCTCAGTCCTGTGGTGTTATAAGAAAGAGCTGGGATTTAGCAGTCA CCGGAAGAAGAGGATGCGGCAGCTACAGAAGAAAATAAAGAGTGGGACCTTGAACTTAAAGCAAGATGAC CCCTTTGAGCTTTTTGTAGCAGCCACAAACATTCGCTACTGCTACTACAATGAAACCCACAAGATTCTGG GCAATACTTTCGGCATGTGTGTCCTCCAGGATTTTGAAGCGTTAACTCCGAACTTGTTGGCCAGAACTGT AGAAACAGTAGAAGGTGGTGGACTGGTGGTCATCCTCCTGCGGACCATGAACTCGCTTAAGCAGCTGTAC ACGATGACTATGGATGTGCATTCCAGGTACAGGACTGAGGCCCATCAGGACGTGGTGGGAAGATTTAACG AGAGGTTTATTCTCTCTCTGGCCTCTTGTAAGAAGTGTCTGGTCATTGACGATCAGCTCGACATCCTGCC CATCTCCTCCCACGTGGCCAGCATTGAAGCCTTACCTCCTCAGGCCCCGGATGAGAATCTCAGTCCTGCT GCTCTGGAGCTGCTGGAGTTGAAAGAGAGCTTGCAGGACACTCAGCCCGTGGGTGTTCTGGTGGACTGCT GCAAGACCCTGGACCAGGCCAAAGCTGTCTTGAAATTCATTGAGGGGATCTCGGAGAAGACTCTAAGGAG TACTGTAGCCCTCACCGCTGCCCGAGGAAGGGGCAAGTCTGCAGCCCTGGGCCTGGCTATCGCTGGAGCA GTGGCATTCGGGTATTCCAATATTTTTGTTACCTCCCCAAGCCCGGATAACCTCCACACGCTGTTTGAAT TTGTATTTAAAGGATTTGATGCTCTGCAGTATCAGGAGCATCTGGATTATGAGATTGTACAGTCGCTGAA CCCCGAGTTTAATAAAGCGGTGATCAGGGTCAATGTGTTCCGAGAGCACAGACAGACTATTCAGTACATC CACCCTGCAGATGCTGTGAAACTGGGCCAGGCTGAGCTGGTTGTGATAGATGAAGCTGCCGCTATTCCCC TCCCCCTGGTGAAGAGCCTGCTTGGGCCCTACCTGGTTTTCATGGCATCTACTATCAATGGCTACGAGGG CACTGGCCGGTCACTGTCCCTCAAGCTCATTCAACAACTCCGTCAGCAGAGTGCCCAGAGCCAGGTCAGC ACCACTGCTGAGAACAAGACCACAACGACAGCCAGACTGGCCTCAGCTCGGACCTTGCATGAGGTTTCCC TCCAAGAGTCAATCCGATACGCCCCTGGGGATGCAGTGGAGAAGTGGCTTAATGACCTGCTGTGCCTGGA TTGCCTCAACATCACCCGCATCGTTTCCGGCTGCCCCTTGCCTGAGGCCTGTGAGCTCTACTATGTTAAC AGAGATACCCTCTTTTGCTACCACAAGGCCTCTGAAGTTTTCCTCCAGCGGCTCATGGCTCTCTATGTGG CTTCTCATTACAAGAACTCTCCCAACGACCTGCAGATGCTCTCAGACGCTCCTGCTCACCACCTCTTCTG CCTCCTGCCACCTGTGCCCCCCACCCAGAATGCCCTGCCTGAAGTGCTTGCAGTTGTCCAGGTGTGCCTT GAGGGAGAGATTTCTCGTCAGTCCATTTTGAATAGCCTCTCTCGAGGCAAGAAGGCTTCTGGGGACCTGA TTCCATGGACAGTGTCGGAACAGTTTCAAGATCCAGACTTTGGAGGCCTTTCTGGTGGACGGGTTGTTCG AATTGCTGTTCACCCAGATTATCAAGGGATGGGATATGGCAGCCGAGCGCTGCAGCTGCTGCAGATGTAT TATGAAGGCAAGTTCCCTTGTCTGGAGGAAAAAGTCTTGGAGACACCACAAGAAATCCGCACCGTGAGCA GTGAGGCTGTCAGCTTGTTGGAAGAAGTTATTACTCCCCGGAAGGATCTGCCCCCCTTGCTCCTCAAGTT GAATGAGAGGCCTGCAGAGCGCCTGGATTACCTGGGGGTTTCCTATGGGCTGACCCCCAGGCTTCTCAAG TTCTGGAAACGAGCTGGATTTGTTCCTGTCTATTTGAGACAGACCCCAAACGACCTGACTGGGGAACACT CGTGCATTATGCTGAAGACGCTGGCCGATGAGGATGAGGCTGAGCAGGGAGCTTGGCTGGCAGCATTTTG GAAAGATTTCCGAAGACGGTTCCTGGCCTTGCTGTCATACCAGTTCAGCACCTTCTCTCCTGCCCTGTCT CTGAACATCATTCAGAACAGGAACGTAGCCAAGTCAGCCCTGCCAGCCCTAGGCCGGGAGCATCTGGAGG CACTTTTCCTTCCCTATGACCTGAAGCGTCTAGAGATGTACTCTCGGAACATGGTCGATTACCACCTCAT CATGGATCTTATCCCAGCCATTTCCCGCTTGTACTTCCTGAACCAGCTAGGAGACCTGTCCCTGTCGGCT GCCCAGTCGGCTCTTCTCTTGGGAATTGGCCTACAGCACAAGTCTGTGGATCAGCTGGAAAAGGAGATTG AGCTGCCCTCAGGCCAGTTGATGGGGCTTTTCAACCGGATCATCCGCAAAGTTGTGAAGCTGTTCAATGA TGTGCAGGAAAAGGCTATTGAGGAGCAGATGGTGGCAGTGAAGGATGTGGTCATGGAGCCCACTATGAAG ACCCTGAGTGATGACCTGGATGAAGCAGCAAAGGAATTCCAGGAGAAACACAAGAAGGAAGTCGGGAAGC TGAAGGACATGGACCTCTCTCAATATGTAATTCGTGGGGACGATGAAGAGTGGAATGAAGTTTTGAGCAA AGCAGGGCAGAATGCCTCCATTGTTAGTTTGAAAAGTGACAAGAAAAGGAAACTGGAAACAAAACAAGAA CCCAAACAGAGCAAGAAGTTGAAGAAGAGAGATAACAACAGAAAGGATATGAAACTGAAGCGAAAGAAGT AGTGAGGTGAGGAGATGCCAGACTTCTGAGCTGTGCTCTGCTGGGCCAGGCCAGGCAGCAGTGTGGACAG TGACAGTGACAGTGACAAGGGCCTTCAGCAAAGGCAGGCACCATCGTTCCATCTGTATGCCCGCCGTGAC TGAAGACAAAGTCACTCTTGAACAGGCTGCTTAGAACTTGGTGTGGGCAAAGCTCTGGCATTGTCAGGGG CTGTCGTTCCACCCAGGTCAGTCTCACTTTGGCTTGCTCCCACTGTGGCTGCTGTGCTGGCTCCTGGCCT CCCTGTGCTCCAGCACACGGCTTTCTGGAGGCACACGCTGCCTCACTGCAGACCTGTCCCGACACTGAGG CTGGGTCAGCAGGACCTCTCCTGCTCCTCCCTTCTATGTCTGCCTGCGGCAGGTCTGCTGTCCTCAGCGT CCCAGGAAAGGCTTAGGTAGGCTGCAACATCTGAGCCCCAGATGCCTTTTGGTTGCCTCTTCATTTGGGA GAGACTATCGAGAAAGACTCTTACTACAAAAATGAGCGGAGAGAGAATATTTTTAATAAATGATGTCTTG GAAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_153126
ORF Size 3075 bp
Insert Size 3075
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC034516, NP_694766
RefSeq Size 3934
RefSeq ORF 3075
Locus ID 98956
Cytogenetics 2|2 E2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)