Prl2c2 (NM_031191) Mouse Untagged Clone
CAT#: MC202789
Prl2c2 (untagged) - Mouse prolactin family 2, subfamily c, member 2 (Prl2c2), (10ug)
"NM_031191" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Prl2c2 |
Synonyms | Ghd2; MRP-1; Plf; PLF-1; Plf1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC080826 sequence for NM_031191
AAGAGGTAATCCCTCCAGTGAAGCATCTTCCCGGAATCCACAGCTAAGCCTGGGTAGGACTCTGCAGAGA TGCTCCCTTCTTTGATTCAACCATGCTCCTGGATACTGCTCCTACTACTGGTGAACAGCTCGTTATTGTG GAAGAATGTTGCCTCATTTCCCATGTGTGCAATGAGGAATGGTCGTTGCTTTATGTCCTTTGAAGACACA TTTGAATTAGCCGGCAGTTTGTCTCATAATATCAGTATAGAAGTTTCAGAACTGTTCACTGAATTTGAAA AACATTATTCTAACGTGTCTGGGCTCAGAGACAAAAGCCCCATGAGATGCAATACTTCTTTCCTTCCAAC TCCAGAAAACAAGGAACAAGCCAGGCTCACACACTATTCAGCTCTTCTGAAATCAGGAGCCATGATTTTG GATGCCTGGGAAAGCCCTCTGGACGATCTAGTGAGTGAATTATCTACCATAAAAAATGTCCCTGATATAA TCATCTCCAAAGCCACAGACATAAAGAAAAAGATCAACGCAGTCCGGAACGGGGTTAATGCCCTCATGAG CACCATGCTTCAGAATGGAGATGAAGAAAAGAAGAACCCTGCCTGGTTCTTGCAATCTGACAATGAAGAT GCTCGCATTCATTCTTTATATGGCATGATCAGCTGCCTAGACAATGACTTTAAGAAGGTTGATATTTATC TCAACGTCCTGAAGTGTTACATGTTAAAAATAGATAACTGCTGATATTTCTTTCATGTGCTCTGCTTCTG AAATATCATGTAATATCCTTTCAATTTGTATCTTTTGAATTTGTTGTTGACTCATTTAAAAATAAAAAGT AGCTCTCAGAAATAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_031191 |
Insert Size | 675 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC080826, AAH80826 |
RefSeq Size | 870 bp |
RefSeq ORF | 675 bp |
Locus ID | 18811 |
UniProt ID | P04095 |
Cytogenetics | 13 5.18 cM |
Gene Summary | May have a role in embryonic development. It is likely to provide a growth stimulus to target cells in maternal and fetal tissues during the development of the embryo at mid-gestation. May play a role during wound healing and in the hair follicle cycle as a growth factor and/or an angiogenesis factor. May play a role in microvilli formation and cell proliferation of neuroblastoma cells.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220404 | Prl2c2 (tGFP-tagged) - Mouse prolactin family 2 subfamily c member 2 (Prl2c2), (10ug) |
USD 500.00 |
|
MR220404 | Prl2c2 (Myc-DDK-tagged) - Mouse prolactin family 2, subfamily c, member 2 (Prl2c2) |
USD 300.00 |
|
MR220404L3 | Lenti ORF clone of Prl2c2 (Myc-DDK-tagged) - Mouse prolactin family 2, subfamily c, member 2 (Prl2c2) |
USD 600.00 |
|
MR220404L4 | Lenti ORF clone of Prl2c2 (mGFP-tagged) - Mouse prolactin family 2, subfamily c, member 2 (Prl2c2) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review