Atp6v0e (NM_025272) Mouse Untagged Clone
CAT#: MC202101
Atp6v0e (untagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit E (Atp6v0e), (10ug)
"NM_025272" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Atp6v0e |
Synonyms | Atp6k; Atp6v0e1; M9.2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024733 sequence for NM_025272
CGAGAGCGAGGCTCAGGACCGATTCGGCTGCTGGGGCGCAGGCATGGCATACCACGGCCTTACTGTGCCT TTGATCGTGATGAGCGTGTTCTGGGGCTTCGTGGGCCTCCTCGTGCCCTGGTTTATCCCCAAGGGTCCTA ACCGGGGAGTTATCATCACCATGTTGGTGACTTGTTCAGTTTGCTGCTATCTCTTTTGGCTGATTGCAAT TCTGGCACAGCTCAATCCTCTGTTTGGACCACAGTTGAAAAATGAAACCATCTGGTATCTGAAGTACCAC TGGCCTTGAGGATGAAGACGCGCTGCACAGTGCCTAGGCACTGAGGTCGCAGACAGAAGCCTTCTGTGCA GAATCACCTGCACATCAGACCTTCCTCCATAGCCCACTTCGGGCGTTACCTGCCTTACACTTGAAGATCT TCCTCTGCATACAGTATTTTTTCCCTTCACCTTTTTTACACTCTGAATTATGTGCCTGCGTAGCTGCCTC TGAGATGTGTCTGCACTCCACTGTTTCGGGAAATGTGTTACTCTTATCTTGAAGCCTGTGGCTTTGAATA TGGCTCTTGCCAGCTCACAACATGAGAGTCAGCGATGTGTTTAAGAATTGCTGCGAGACAAACAAGACTC GGCGGGACAGTCAGGAGTGCCTGCTCAAGAGGAGCCCTACCCCAGCAGATGTACACCAAGCTCTATTTTC AGGATGAATTTCTTACTTCTACATCTTTGGGAATAAATTATTTTTCTTCTTTCTATGGGAAAAAAAAAAA AAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025272 |
Insert Size | 246 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024733, AAH24733 |
RefSeq Size | 782 bp |
RefSeq ORF | 246 bp |
Locus ID | 11974 |
UniProt ID | Q9CQD8 |
Cytogenetics | 17 A3.3 |
Gene Summary | Vacuolar ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200150 | Atp6v0e (tGFP-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit E (Atp6v0e) |
USD 350.00 |
|
MR200150 | Atp6v0e (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit E (Atp6v0e) |
USD 150.00 |
|
MR200150L3 | Lenti ORF clone of Atp6v0e (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit E (Atp6v0e) |
USD 450.00 |
|
MR200150L4 | Lenti ORF clone of Atp6v0e (mGFP-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit E (Atp6v0e) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review