Jaml (NM_001005421) Mouse Untagged Clone
CAT#: MC201873
Amica1 (untagged) - Mouse adhesion molecule, interacts with CXADR antigen 1 (Amica1), (10ug)
"NM_001005421" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Jaml |
Synonyms | AMICA; Amica1; Crea7; Gm638 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001005421, the custom clone sequence may differ by one or more nucleotides
CCCAGACAGAATCTGGCTCACATTGGCACTCACTGTTAGTTTGTTCAGTTAACAGTGTTCTCTGGATATA ATTTTCTGATTTCTTTTTTAATCTTAAGATTGAAAACTTGAAAGGATAATGCTTTGCCTCCTGAAACTGA TTGTGATTCCAGTAATCCTGGCCCCTGTAGGTTATCCACAGGGCCTGCCAGGCTTGACCGTTTCCTCCCC TCAGCTGAGAGTGCATGTGGGTGAATCAGTCTTGATGGGATGTGTTGTCCAGCGCACAGAAGAGAAACAC GTGGACAGAGTGGATTGGCTCTTCTCGAAAGATAAAGATGATGCGAGTGAATATGTGCTGTTCTACTATT CCAACCTTAGCGTGCCTACGGGGCGCTTCCAGAACCGGTCACATTTGGTGGGGGACACCTTCCATAATGA TGGTTCTCTCCTGCTCCAAGATGTTCAGAAGGCCGATGAGGGAATCTACACCTGTGAAATCCGCCTCAAA AATGAGAGCATGGTGATGAAAAAGCCCGTGGAACTGTGGGTGCTACCAGAGGAACCTAAAGATCTCAGAG TCCGAGTAGGTGATACAACTCAGATGAGATGTTCTATCCAGAGCACAGAAGAGAAACGGGTGACCAAAGT AAACTGGATGTTTTCTTCAGGGAGCCATACTGAGGAGGAGACAGTCTTGAGCTATGACTCCAACATGCGT AGTGGAAAATTCCAGAGCCTGGGCCGCTTCCGCAACCGTGTAGACCTGACAGGTGACATCTCCCGCAATG ATGGCTCAATCAAACTTCAAACAGTGAAGGAGTCTGACCGAGGAATCTACACTTGCAGCATCTACGTGGG AAAGCTGGAGTCCAGGAAAACCATTGTGCTGCATGTGGTCCAGGACGAATTTCAAAGGACAATTTCACCA ACTCCTCCAACTGATAAGGGTCAGCAGGGCATCCTGAATGGAAATCAGCTGGTGATCATTGTGGGGATCG TCTGTGCCACCTTCCTGCTGCTTCCGGTTTTGATATTAATTGTGAAGAAAGCCAAGTGGAATAAGAGCTC AGTAAGTTCTATGGCTTCTGTGAAGAGCCTGGAGAACAAAGAGAAGATTAATCCAGAGAAGCATATCTAC TCCTCCATAACTACGTGGGAGACGACAGAGAGAGGAATAAGTGGAGAGTCAGAGGGCACCTACATGACCA TGAATCCAGTTTGGCCTTCTTCCCCCAAAGCATCCAGTTTGGTCCGCTCTTCAGTCAGATCCAAGTAATG TGGTTGAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_001005421 |
Insert Size | 1140 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC050133, AAH50133 |
RefSeq Size | 1284 bp |
RefSeq ORF | 1140 bp |
Locus ID | 270152 |
UniProt ID | Q80UL9 |
Cytogenetics | 9 A5.2 |
Gene Summary | Transmembrane protein of the plasma membrane of leukocytes that control their migration and activation through interaction with CXADR, a plasma membrane receptor found on adjacent epithelial and endothelial cells. The interaction between both receptors mediates the activation of gamma-delta T-cells, a subpopulation of T-cells residing in epithelia and involved in tissue homeostasis and repair. Upon epithelial CXADR-binding, JAML induces downstream cell signaling events in gamma-delta T-cells through PI3-kinase and MAP kinases. It results in proliferation and production of cytokines and growth factors by T-cells that in turn stimulate epithelial tissues repair. It also controls the transmigration of leukocytes within epithelial and endothelial tissues through adhesive interactions with epithelial and endothelial CXADR.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG205923 | Amica1 (tGFP-tagged) - Mouse adhesion molecule, interacts with CXADR antigen 1 (Amica1) |
USD 657.00 |
|
MR205923 | Amica1 (Myc-DDK-tagged) - Mouse adhesion molecule, interacts with CXADR antigen 1 (Amica1) |
USD 457.00 |
|
MR205923L3 | Lenti ORF clone of Amica1 (Myc-DDK-tagged) - Mouse adhesion molecule, interacts with CXADR antigen 1 (Amica1) |
USD 757.00 |
|
MR205923L4 | Lenti ORF clone of Amica1 (mGFP-tagged) - Mouse adhesion molecule, interacts with CXADR antigen 1 (Amica1) |
USD 757.00 |
{0} Product Review(s)
Be the first one to submit a review