Jaml (NM_001005421) Mouse Untagged Clone

CAT#: MC201873

Amica1 (untagged) - Mouse adhesion molecule, interacts with CXADR antigen 1 (Amica1), (10ug)


  "NM_001005421" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Jaml"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Jaml
Synonyms AMICA; Amica1; Crea7; Gm638
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001005421, the custom clone sequence may differ by one or more nucleotides


CCCAGACAGAATCTGGCTCACATTGGCACTCACTGTTAGTTTGTTCAGTTAACAGTGTTCTCTGGATATA
ATTTTCTGATTTCTTTTTTAATCTTAAGATTGAAAACTTGAAAGGATAATGCTTTGCCTCCTGAAACTGA
TTGTGATTCCAGTAATCCTGGCCCCTGTAGGTTATCCACAGGGCCTGCCAGGCTTGACCGTTTCCTCCCC
TCAGCTGAGAGTGCATGTGGGTGAATCAGTCTTGATGGGATGTGTTGTCCAGCGCACAGAAGAGAAACAC
GTGGACAGAGTGGATTGGCTCTTCTCGAAAGATAAAGATGATGCGAGTGAATATGTGCTGTTCTACTATT
CCAACCTTAGCGTGCCTACGGGGCGCTTCCAGAACCGGTCACATTTGGTGGGGGACACCTTCCATAATGA
TGGTTCTCTCCTGCTCCAAGATGTTCAGAAGGCCGATGAGGGAATCTACACCTGTGAAATCCGCCTCAAA
AATGAGAGCATGGTGATGAAAAAGCCCGTGGAACTGTGGGTGCTACCAGAGGAACCTAAAGATCTCAGAG
TCCGAGTAGGTGATACAACTCAGATGAGATGTTCTATCCAGAGCACAGAAGAGAAACGGGTGACCAAAGT
AAACTGGATGTTTTCTTCAGGGAGCCATACTGAGGAGGAGACAGTCTTGAGCTATGACTCCAACATGCGT
AGTGGAAAATTCCAGAGCCTGGGCCGCTTCCGCAACCGTGTAGACCTGACAGGTGACATCTCCCGCAATG
ATGGCTCAATCAAACTTCAAACAGTGAAGGAGTCTGACCGAGGAATCTACACTTGCAGCATCTACGTGGG
AAAGCTGGAGTCCAGGAAAACCATTGTGCTGCATGTGGTCCAGGACGAATTTCAAAGGACAATTTCACCA
ACTCCTCCAACTGATAAGGGTCAGCAGGGCATCCTGAATGGAAATCAGCTGGTGATCATTGTGGGGATCG
TCTGTGCCACCTTCCTGCTGCTTCCGGTTTTGATATTAATTGTGAAGAAAGCCAAGTGGAATAAGAGCTC
AGTAAGTTCTATGGCTTCTGTGAAGAGCCTGGAGAACAAAGAGAAGATTAATCCAGAGAAGCATATCTAC
TCCTCCATAACTACGTGGGAGACGACAGAGAGAGGAATAAGTGGAGAGTCAGAGGGCACCTACATGACCA
TGAATCCAGTTTGGCCTTCTTCCCCCAAAGCATCCAGTTTGGTCCGCTCTTCAGTCAGATCCAAGTAATG
TGGTTGAAAAAAAAAAAAAAAAAA


Restriction Sites RsrII-NotI     
ACCN NM_001005421
Insert Size 1140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC050133, AAH50133
RefSeq Size 1284 bp
RefSeq ORF 1140 bp
Locus ID 270152
UniProt ID Q80UL9
Cytogenetics 9 A5.2
Gene Summary Transmembrane protein of the plasma membrane of leukocytes that control their migration and activation through interaction with CXADR, a plasma membrane receptor found on adjacent epithelial and endothelial cells. The interaction between both receptors mediates the activation of gamma-delta T-cells, a subpopulation of T-cells residing in epithelia and involved in tissue homeostasis and repair. Upon epithelial CXADR-binding, JAML induces downstream cell signaling events in gamma-delta T-cells through PI3-kinase and MAP kinases. It results in proliferation and production of cytokines and growth factors by T-cells that in turn stimulate epithelial tissues repair. It also controls the transmigration of leukocytes within epithelial and endothelial tissues through adhesive interactions with epithelial and endothelial CXADR.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.