Pkig (NM_011106) Mouse Untagged Clone

CAT#: MC201822

Reviews ()
Write a review

Pkig (untagged) - Mouse protein kinase inhibitor, gamma (Pkig), transcript variant 1, (10ug)



  "NM_011106" in other vectors (4)

USD 210.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Pkig (NM_011106) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pkig
Synonyms PKIgamma
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC026550 sequence for NM_011106
CCCACGCGTCCGCGGACGCGTGGGCGGACGCGTGGGGGGCGCCAGGCGGCCCCGGGGAGGCGCTCGCGCC GGCGGCCGGGGCTCTACGAGGCGACAAGGCGGCAGACTTTCTGCACTGGCTAATCAAGAGTGAAAAACCT GAAGAGATGCAGGCAGGAAAACGGAATTAAACTAGGCCTGAGGAGCGATGAGACAGGCATGATGGAAGTC GAGTCCTCCTACTCGGACTTCATCTCCTGCGACCGGACAGGCCGTCGGAATGCAGTCCCTGACATCCAGG GTGACTCGGAGGCCGTGAGTGTGCGGAAGCTCGCTGGAGACATGGGCGAGCTCGCACTTGAGGGAGCAGA AGGACAGGCAGAGGGAAGTACCCCCGACAAGGAAGCCAGCAGCCAGCCTGAGAGCAGTGATGCGAACACC TCATCCTGAGTCTGCCTGTGGTCGCAAGGCTGGAAGAGACCTGCTGTACCTCTCGGACTGGAGCCCTGGC CAGCCAGGCGGACTGAGAGCCTCATGGAGTCCTCTGTGGCCCCCACTCCAGCCAAGTCCTCCACCCACAG CACAGGCTCCACCCTTCCCCACCTCCCCACGGTGCCCAGGTTCACTCTGAAGACACCAGCACCATGAGAT GTTATTTATTCAGCTAGGCGGGGCTCGAGCCAGGCCCTGCCCCTAGGTGAGCAGCCGCCACCTGGACAGG GACTGTCCTGTCACCACTCACCCTCCAGCCAGCCTGTCTGTCAGGAAGATCTTCCTAGCCCTTTTTTAAA GCCTCTTTTACATTTTTTAAAAACATAACTTTTTCAGAGAGAGAGGGGAGCTGACAATCACTTTTCTTCT GTTTTGGTTTTTGGTTTTGGTTTTTGTTTTGAAAGCCGTTTAAAGCTCAGTTCTGATGATCTATGCAGCT CTAAGTTTCCTCATGGAGCCTCACAGATCCAGTTTTGGGAAAGGATTTGGACTCAAAACTAACTGACCAA TTCTTTGCCCTTTGTACCAAGAGACTGATACTTAGGCCCAGGAAATAAATGCTGGTGGTTTGTGAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_011106
Insert Size 231 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC026550, AAH26550
RefSeq Size 1087 bp
RefSeq ORF 231 bp
Locus ID 18769
Cytogenetics 2 84.4 cM

Other Versions

Other products for "Pkig"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools