Lypd8 (NM_027339) Mouse Untagged Clone

CAT#: MC201454

Lypd8 (untagged) - Mouse RIKEN cDNA 2210415F13 gene (2210415F13Rik), transcript variant 2, (10ug)


  "NM_027339" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Lypd8"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lypd8
Synonyms 2210415F13Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC026828 sequence for NM_027339
TTCCATCTTCCTCCGGATAGTGTCCCTGGCTGGACCCAGAAGGTTTGAGGCTCTGTGGCCCCATCCTCTG GGGAAGCCAACTCCAGCATCATGAGAGGCGTCTTCATCGCTGGTGTCATTGCGGCATTCGCCATCACAGT TGTAGACTCCCTGAATTGTACACAGTGTCATACGTACAATAGCACCTGTGATGGCCAGGCCACTGAATGC AATGAGCAGTCCTTCAGTTGTGTGGAGTCCTCTATCAACTCCACTCTAGGAGGGTTCCTGCATGTGTACC AGAACAAGTTCTGCTCCGAATCGAATTGCACCAAGAACAGCACAGAGGTGGCCTTCACTGTCCATCTATT TGATGACCAAAGATACCATTTTGCAAGCCAGTGCTGCCAAGGAGAGTCCTGCAATGCCACCCACTCTGAA TCCGGAACACAGAATGTAACTGACATGCAGTGCATGTCTTGCTATGGTCACAACAAAACACTCTGCGAGG AGAAACCCCAAAAGTGTTACGAAGGAGAACAATGTGTCTTCATCATTGCGGAGATGGTAAATGGCTCTGG CAGAGTGGAGCTGAAGGGCTGTTCTGATATCAGCAACTCTACTTGTCAATTCCTGTCCCCTGGGAACACA ACAGTTGGAGAGTTTGTTTTCAAGTCGGTTGAATGTACGCAACCCACTGAGTATACCAACTCGACCACCA CTATCCCACCAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACACTTCCCTCACCTC TGTTACCCGACCAGGCATCAAAACTTCCCCCGCCTCTGTTACCCCACAGGCTAGCATGGGCACCAAAGCT TCCTTCACCTCCTCTATCTTCGGCAGCCTTCTTCTTCTGAAGCTGCTGTTCTGAGGTTCCTGGGCTCTGC TCCATCCAGTATCCCATGGGTGTCAACACCTTTCTCTTCATATACCTTCCAGTTAGACTGTCCAGTGGGT TGGAAGTCACAGGACTCCAGGCAATGCTAGCAGCCACAGTATCTCCTTTATTAAAGTGTTGCTTGAGGTC TAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_027339
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC026828, AAH26828
RefSeq Size 1070 bp
RefSeq ORF 804 bp
Locus ID 70163
UniProt ID Q9D7S0
Cytogenetics 11 B1.3
Gene Summary This gene encodes a member of the Ly6/PLAUR family of cysteine-rich proteins that plays an important role in the protection of colonic epithelium from flagellated microbiota. The encoded protein undergoes proteolytic processing to generate a mature, glycosylphosphatidylinositol-anchored protein that is localized to the apical surface of the colonic epithelial cells. Mice lacking the encoded protein are sensitive to chemically induced intestinal inflammation. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 - 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.