Tmem30a (NM_133718) Mouse Untagged Clone

CAT#: MC200840

Tmem30a (untagged) - Mouse transmembrane protein 30A (Tmem30a), (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem30a (NM_133718) Mouse Untagged Clone
Symbol Tmem30a
Synonyms 2010200I23Rik; AW540225; Cdc50a; D9Wsu20e
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC018367 sequence for NM_133718
CGGACGCGTGGGCGGCACGCAAGTCCCCTGGGCGGCCCAGCTGGACGTGGCCGAGCCGAAGCCCGGGGGC CGATGGCGATGAACTATAGCGCGAAGGATGAGGTGGACGGCGGGCCCGCGGGTCCTCCCGGGGGCGCCGC CAAGACCCGGAGGCCGGATAACACGGCCTTCAAACAGCAACGGCTACCCGCCTGGCAGCCCATCCTCACG GCCGGCACGGTGCTGCCCACCTTCTTCATCATCGGCCTCATCTTCATCCCCATCGGCATCGGCATCTTCG TCACCTCCAACAACATCCGTGAGATCGAGATTGATTACACTGGAACAGAACCTTCCAGCCCCTGCAATAA ATGTTTATCTCCGAATGTGACATCTTGTGCTTGTACCATTAACTTCACACTGAAACAGTCATTTGAGGGC AATGTGTTTATGTATTATGGACTGTCTAATTTCTATCAAAATCATCGTCGCTACGTGAAATCTCGAGATG ATAGCCAGTTAAATGGAGACCCTAGTGCTTTGCTTAATCCAAGTAAGGAATGTGAACCTTATAGAAGAAA TGAAGACAGACCAATTGCGCCATGTGGCGCTATTGCCAACAGCATGTTTAATGATACGTTAGAATTGTAT CTGGTTGCCAATGAATCTGATCCCAAGCCTATTCCAATTCCTTTGAAGAAAAAAGGTATTGCTTGGTGGA CAGATAAAAATGTGAAATTCAGAAATCCACCTGGAAAAGAGAGCCTCGAAGAAAAGTTTAAAGATACAAT AAAGCCAGTAAACTGGCATAAGGCAGTATATGAGCTAGACCCTGAAGATGAAAGTAATAATGGATTCATA AATGAAGACTTTATAGTTTGGATGCGTACTGCAGCATTACCTACTTTTCGTAAGTTGTATCGTCTCATAG AGCGGAGAGATGATTTACACCCAACATTACCAGCTGGACAGTACTTTTTGAACATCACATACAATTACCC TGTGCATTCCTTTGATGGACGGAAACGGATGATCTTGAGCACTATTTCATGGATGGGAGGAAAGAATCCA TTTTTGGGAATTGCTTACATCACTATTGGATCCATCTCTTTCCTTCTGGGAGTTGTACTGCTAGTAATTA ATCATAAATATAGAAACAGTAGTAACACTGCTGACATCACCATTTAATTTTATATTCTGAAACCAAATCT ACTGCATGTGCATCAAGGCCAGTCCTGTTCAACCTAGCTTTTGAATGCTGATGTCTGGTTAGTATGTCAT TTTGAAGTTGGCACATAACTTTAAAAAAACAAAACAAACAAAACAGCCTTTGTTCTTTGCTTCTTACATA TGGATGACTTATGAAAATATATGATGGATATAAAAATTAGCCATATTGATTATATCAATATTGTAACTGC TAAAATGACATTCTAATGTCTGCTTTTTATTGGGACAGGCCATGTGATGCATAGAGCCTCTTTCCTATGA AATGCGTCTACTGCTTAAACTGTTGATGCTGTGTTGATAACATATTGACATGATGCTGTATATGTGTGCC TACTGTGTGATGAAAGGGATTATGAGATGTATGAGTGTAATGACTTGCTAACCTTTGAAAATTTGGTTAC AGTTCAGATAGAAGAAAGACTATAAATAAAACACTTCATCATTTTCATGTGTCGTGTGTAAAGGCTTAAA GTCCCTCCTTGTTGAGGTGGTTCATATGTTCAGTTGCTCTATTATGATTCTCCGATAATGACGTTGACTT CACACTTTAGCTTGTACAACATAGAAATTAATATCTAAAGAGGTCAGTGGGTCTTGGCTAGAATTTTAAA TTTCTTCTCATTTGAGTAAAATGTTGCATTCTGAAGTCCCATGCTACCTGAAGTTGCATTTGGAGTCCCA AGCTACTGGAATGTTTATATGTGACCGTTTCCCAGGAGGCTTACACTGCAGAAGGAAGAATGAATCTAGG TGAGGTGGGCAGCTGCTTGGCAGTCCTCTCTTGTGCCCCAACTGTAAACCAGATAGAAATGTTCAGGGGA GGATACTTTCATTATTGTGGTTTGTAGTGTTAAGATGATTGCTTCTGCCTTGGAAATACCTCAAGCTGTT CTTATTTAACAGGTAAGTGACTGAGTATAATATTCCAGAAAAATTTGAAATCCTAATTTCTTCCATATTT CATTAAATTTTTTTGCATACAGGTCTAACAAATATGGATATGTATACACATCCTCTTTAATGAAGGTATT ATTTTGGTTACTTTTCCTAAGATATACCTTAAAAGATGTTCTATACATTTCCTACTTAAATTCTGGGGGA TTTGGAGTATGTACATGATAAAAAAGATTATAATATATCGATTGAAGTTACTTTATTTTCTAATTAGAAT TATTTTAATAGTCCTTTATTGAATAAGTGCTGTAATTTGTTTGCTATGAGACTTATTCCTGATGTGAATG TAAATTATTTTTCCACATGCATGAAAAAATGTATGTACTAATCAGAGTTGTCTCCATTGCATTGAAATTA CTTGTTTTGAACTAAAGTAACTCATATTTATGTAGTAGAATGCTTATGTTTTCAGACTTTGTAATGATTT CCTTTGGATGTATTTTAAATCAATCGGTCTGGGTAACATATCAGTTTAGATTAATATGTGCTTAAAAGAA GAAAAAAATTCAATGGTTCATAGTAGAAATGTGCCACACTTAAATAAGCTCTGTATGACATGAAATTCTG TTAAAACATTGTAATTCATGGTGACTTTTAACTTATAAAAATACTACTTGCACGGGTTACTTGATTTATG GATATATGAAAACTTCTCAGGACGAAAGTTCTTCTTTCTCTAGAACTATTCTTCTGTCGGTCATGCAGAA TGCTGTTATTCTGAAAAGTGTCCCTGTTGCATATGATGGTCACTTTATTTGGGGGGATTCTTCATAAGAT GTGAGATGTTGATGCCAGTCTTTCCCAAGTAAGTGCTCGTAAAAAAGGACTACTAACTAGCCTGCATCTG TCTCTAACTGGGACCAAGGGGTCTGCTGAAGGAAACTGAAGAGCTCTAACATTTTCACAGCTTGGAGAAG ATAGAATCTTTAAAAGTACAACTGAAGCTTGATCTATTTTACAAGTGCATTGATGGCCCCTGTCCTTTTT TGGTTCCTGTCATTTGAAACCAACTCCTGTTGTAAATAGGAAGAATATGGGACATTCATATTTAAGAAAA TTTGATGTCATTAGGGGACTAAGTAGAAGGGTTAGAAAAAAGTATTCATTTGCAAGTATTTTGGCCCAAG AAATTTTCCAACTGAATAGTAAGCAAAAGGTAAGTTGTTTCATTGAAATCATAAGGCAGTTTAAGATAAA CTGGGGAAGATAACTGTTTTAATAGAGGATAATCGAATTGATTGTCAAGTGGATGTTATTTATTGGATAG GGACAGAGTTTATTTGTAACCTTAATTATATTAAAAGTTATTCTGTTAGGATGTTTTGTATTAATAAACG TGAACAAAATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_133718
ORF Size 1095 bp
Insert Size 1095
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC018367, NP_598479
RefSeq Size 3555
RefSeq ORF 1095
Locus ID 69981
Cytogenetics 9 E1|9 43.82 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.