Acy1 (NM_025371) Mouse Untagged Clone

CAT#: MC200771

Reviews ()
Write a review

Acy1 (untagged) - Mouse aminoacylase 1 (Acy1), (10ug)



Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product images

Other products for "Acy1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Acy1
Synonyms 1110014J22Rik; Acy-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005631 sequence for NM_025371
CCCACGCGTCCGCCGGGCGGTTTTGAGATTGGGAGCGACCTCGGTGGACCCTGAGTTCCGGCCACAGTCT GAGAGGAGAGCACAGGACTGAGACGTGGAGAGAGCAAGCCAGCACGCGGCGCCATGACCACCAAGGATCC CGAGTCTGAGCACCCCTCCGTGACGCTCTTCCGCCAGTACCTGCGCATCTGCACTGTGCAACCCAATCCA GACTATGGAGGGGCCATCACCTTCCTGGAGGAGAGAGCCCGCCAGCTGGGTCTGAGCTGTCAGAAAATAG AGGTGGTGCCTGGCTTTGTGATCACTGTGCTGACCTGGCCAGGCACCAACCCGTCACTCCCCTCCATCTT GCTAAACTCCCACACAGATGTGGTACCTGTCTTCAAGGAACATTGGCATCACGACCCCTTTGAGGCCTTC AAGGATTCCGAGGGCTACATCTATGCTAGGGGCTCCCAGGACATGAAGAGTGTCAGCATCCAGTACCTGG AAGCTGTGAGGAGGCTGAAGAGCGAGGGCCACCGATTCCCTAGGACCATCCACATGACCTTTGTGCCTGA TGAGGAGGTCGGAGGTCACAAGGGGATGGAGTTGTTTGTGAAGAGGCCTGAGTTCCAGGCTCTGCGGGCA GGCTTCGCTCTGGACGAGGGCCTGGCCAACCCCACGGATGCCTTTACTGTCTTTTATAGTGAGCGGAGTC CTTGGTGGGTACGGGTTACCAGCACTGGGAAGCCAGGCCATGCCTCACGCTTCATTGAGGATACAGCTGC AGAGAAGTTGCATAAGGTTATAAGCTCCATCTTGGCATTCCGGGAGAAGGAAAGGCAGAGGCTGCAGGCG AACCCTCACCTGAAGGAAGGCGCTGTGACTTCGGTGAATCTGACCAAGCTTGAAGGTGGCGTGGCCTATA ATGTGGTACCTGCCACTATGAGTGCCAGCTTTGACTTCCGAGTGGCACCAGATGTAGACATGAAGGCCTT CGAGAAGCAGCTGCAGAGATGGTGCCAGGAAGCGGGAGAGGGGGTCACCTTTGAGTTTGCTCAGAAGTTT ACAGAGCCTCGAATGACACCCACGGATGATTCAGATCCCTGGTGGGCAGCTTTCAGCGGAGCCTGCAAGG CAATGAACCTCACTCTGGAGCCAGAGATCTTTCCTGCTGCCACTGACAGCCGCTATATCCGAGCGGTGGG GATCCCAGCTCTGGGCTTCTCGCCCATGAACCGCACACCTGTCCTGCTACATGACCATAATGAACGGCTG CATGAGGATATATTTCTCCGTGGGGTTGACATATATACAGGCCTCCTCTCTGCACTTGCTAGTGTGCCCA CCCTGCCTGGTGAAAGTTGAGCCCCAGGGCTTCCAACTCTTGTACTCTCAGTCCTACCACTGCCAAGGAT CTGTTTCCCCTGCCCAGTAATAAAGCCAGCATTGGATGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025371
Insert Size 1227 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC005631, AAH05631
RefSeq Size 1469 bp
RefSeq ORF 1227 bp
Locus ID 109652
UniProt ID Q99JW2
Cytogenetics 9 57.49 cM
Gene Summary Involved in the hydrolysis of N-acylated or N-acetylated amino acids (except L-aspartate).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.