S100a13 (BC005687) Mouse Untagged Clone

CAT#: MC200570

S100a13 (untagged) - Mouse S100 calcium binding protein A13 (cDNA clone MGC:11475 IMAGE:3155915), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: S100a13
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC005687
  GCTTGCACCACCTCCCTGAGCCTAGCGGGAACAGCAGTAGCAGTCCCTCTAACACAGACTCCCAAGTAGC CCTCATAATTGGGAGGGATGAGACCCTGTGGTCCTTCCTGATCAGGCTGTGTCCCAGTCGCGTGGCGCTG TGTTGGGATGGCTAGTGACAGCAGGGGCGGTCCCCTCAGCGGAGGCGGAAACTTGACACTTCAGACTTGG GAGTGGCTCTCGCCTTGCCTGGTGCTTATAAACTTCAGCCTCAGGGCTCCAGATCGGTTAGCTGCATCCC ACCTTCTTTCCCGGTCAATCTGTGTGGACATCAGCTCCTGCTTTGGTATACTGATGGCAGCAGAGACTCT GACTGAACTGGAGGCGGCCATTGAGACTGTGGTCTCTACTTTCTTCACCTTTGCAGGGCGGGAAGGACGC AAAGGCAGCCTGAACATCAATGAATTTAAGGAACTGGCCACTCAGCAACTGCCTCATTTGCTCAAGGACG TGGGCTCTCTAGATGAAAAGATGAAGACCTTGGATGTGAATCAGGACTCAGAGCTGAGGTTCAGTGAATA CTGGAGACTGATTGGAGAGCTGGCAAAGGAAGTCAGGAAGGAGAAGGCCCTGGGGATCCGGAAGAAGTAA AGCTTGCTGTCCAGCAGGACCTGTTGGGCAGAGCCAGGCAGCACTCCACCCCTGCCCCCAAATAAAGCTT TCTTCTTGAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: BC005687
• Insert Size: 297 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC005687, AAH05687
• RefSeq Size: 723 bp
• RefSeq ORF: 297 bp
• Locus ID: 20196
• Cytogenetics: 3 39.24 cM
• Gene Summary: Plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway. Binds two calcium ions per subunit. Binds one copper ion. Binding of one copper ion does not interfere with calcium binding. Required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine.[UniProtKB/Swiss-Prot Function]