Derl2 (NM_033562) Mouse Untagged Clone

CAT#: MC200559

Derl2 (untagged) - Mouse Der1-like domain family, member 2 (Derl2), (10ug)


  "NM_033562" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Derl2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Derl2
Synonyms CGI-101; Derlin-2; F-lana; Flana
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005682 sequence for NM_033562
GGAAAGATGGCGTACCAGAGCCTCCGGCTGGAGTACCTGCAGATCCCGCCGGTCAGCCGCGCCTATACTA CCGCCTGCGTCCTCACCACCGCGGCCGTGCAGTTGGAATTGATCACACCTTTTCAGTTATACTTCAATCC TGAATTAATTTTTAAACATTTTCAAATCTGGAGGCTAATCACCAATTTCTTATTTTTTGGTCCAGTTGGA TTCAATTTTTTGTTTAACATGATTTTTCTATACCGTTATTGTCGAATGCTAGAAGAAGGCTCTTTCCGAG GTCGGACAGCAGACTTTGTATTTATGTTCCTTTTTGGTGGATTTTTAATGACTCTCTTTGGTTTGTTTGT GAGCTTAGTTTTTTTAGGCCAGGCCTTTACAATAATGCTGGTCTACGTGTGGAGCCGAAGGAACCCGTAT GTCCGCATGAACTTCTTTGGTCTTCTAAACTTCCAGGCCCCCTTCCTGCCCTGGGTGCTCATGGGGTTTT CCCTGTTGCTGGGGAACTCAATTATAGTGGACCTTTTGGGTATTGCAGTTGGGCACATATATTTTTTCTT GGAAGATATATTTCCCAATCAGCCTGGTGGAATAAGAATTCTGAAAACACCATCTATTTTGAGGACTATT TTTGATACGCCAGATGAGGATCCCAATTACAACCCACTACCTGAAGAGCGGCCGGGAGGCTTCGCCTGGG GTGAGGGCCAGCGCCTTGGTGGGTAAAGCAGCGGTGCCAATTACGAGACCCATCTGAGAAAGACTCAGTG ACATGTCCATGGGGGTCTTTTATCCCTTGTTGCAAAAGCGTGGACAGTTTTGACAGCTTGACAGATTTTT AACTCCAGAAGCACTTTACGGGATGGTACACTGACTAACATAGAAGACATTTCCAGGAGTTTGCCAGGGG TTCCTCACTATGCTGGTACTAAAAGTATAACCTCTTGGAGCCAAAAACTGGAGACCCAGGCACCCTGCCT GTGCCGTGAGCAAGTCCATGGGTACTTGAGCTCAGTGGCACAGGCGGGTGCTCCTCCTCCTCTTTGATAG ACAAGGCCGTGGTGTAAATGGAAGTTACGGAGAGGACAAAATAAAACTGAATTCCATCTCTCTCACACTG TAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_033562
Insert Size 720 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC005682, AAH05682
RefSeq Size 1137 bp
RefSeq ORF 720 bp
Locus ID 116891
UniProt ID Q8BNI4
Cytogenetics 11 43.21 cM
Gene Summary Functional component of endoplasmic reticulum-associated degradation (ERAD) for misfolded lumenal glycoproteins, but not that of misfolded nonglycoproteins. May act by forming a channel that allows the retrotranslocation of misfolded glycoproteins into the cytosol where they are ubiquitinated and degraded by the proteasome. May mediate the interaction between VCP and misfolded glycoproteins. May also be involved in endoplasmic reticulum stress-induced pre-emptive quality control, a mechanism that selectively attenuates the translocation of newly synthesized proteins into the endoplasmic reticulum and reroutes them to the cytosol for proteasomal degradation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.