Tsn (NM_011650) Mouse Untagged Clone

CAT#: MC200147

Tsn (untagged) - Mouse translin (Tsn), (10ug)


  "NM_011650" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tsn
Synonyms 2610034C24Rik; AU040286; C3PO; TB-RBP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC004615 sequence for NM_011650
CCCACGCGTCCGGCGACGGCGACGGGCGTTGCGAGCGAGTCCGCTACTTGTTTGTGGGTCGTACTTCTTC GGCGGTGCTCCGGTGCTGACTGATTGTAGGGCAGCCAGCGCCATGTCTGTGAGCGAGATCTTCGTGGAGC TGCAGGGCTTTTTGGCTGCCGAGCAGGACATCCGAGAGGAAATACGAAAAGTTGTACAGAGTTTAGAACA AACTGCTCGAGAGATTTTGACCCTACTTCAAGGGGTCCACCAGGGTACTGGATTTCAGGACATTCCAAAG AGGTGCTTGAAAGCGAGAGAACATTTCAGTACAGTAAAAACACATCTCACATCCCTGAAGACCAAGTTCC CCGCTGAGCAGTATTACAGGTTTCATGAGCATTGGCGGTTCGTGCTTCAGCGCCTGGTCTTCCTGGCAGC ATTTGTGGTATATTTGGAAACAGAGACCCTGGTGACCCGAGAGGCTGTTACAGAGATTCTTGGCATTGAA CCAGATCGGGAAAAAGGGTTTCATCTGGATGTGGAAGATTATCTCTCAGGAGTTTTAATTCTTGCCAGTG AACTGTCGAGGCTGTCTGTCAACAGTGTCACTGCTGGAGACTACTCTCGGCCCCTTCACATTTCTACTTT CATCAATGAGCTGGATTCTGGTTTTCGTCTTCTCAATCTGAAAAATGACTCCCTGAGGAAGCGCTACGAC GGCTTGAAGTACGATGTGAAGAAAGTAGAGGAGGTGGTCTATGACCTTTCCATCCGAGGCTTCAATAAGG AGACAGCAGCGGCTTGTGGTGAAAAATAGGAGCTTTTCCCTGGGGCTGGCCTTGCTGGCGCTGCAGTTGC CAGGGAGGGCTAGCTCAGTGCCTCTTCCTGTAGTTAGCACACCAGTTGCTAAACACTGCGCTTTATTTTC GTAACCAGCTGTGTGCTGTGAGTGTCAGAATTGAAATACTTTTTGGATCTAAACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_011650
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC004615, AAH04615
RefSeq Size 979 bp
RefSeq ORF 687 bp
Locus ID 22099
UniProt ID Q62348
Cytogenetics 1 E2.3
Gene Summary DNA-binding protein that specifically recognizes consensus sequences at the breakpoint junctions in chromosomal translocations, mostly involving immunoglobulin (Ig)/T-cell receptor gene segments. Seems to recognize single-stranded DNA ends generated by staggered breaks occurring at recombination hot spots.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer, protein-coding variant. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.