HB EGF(HBEGF) (NM_001945) Human 3' UTR Clone

CAT#: SC214809

3`UTR clone of heparin-binding EGF-like growth factor (HBEGF) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
1 Week

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HB EGF(HBEGF) (NM_001945) Human 3' UTR Clone
Vector pMirTarget
Symbol HBEGF
Synonyms DTR; DTS; DTSF; HEGFL
ACCN NM_001945
Insert Size 1467
Sequence Data
>SC214809 3'UTR clone of NM_001945
The sequence shown below is from the reference sequence of NM_001945. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGCATGACTAATTCCCACTGAGAGAGACTTGTGCTCAAGGAATCGGCTGGGGACTGCTACCTCTGAGAAG
ACACAAGGTGATTTCAGACTGCAGAGGGGAAAGACTTCCATCTAGTCACAAAGACTCCTTCGTCCCCAGT
TGCCGTCTAGGATTGGGCCTCCCATAATTGCTTTGCCAAAATACCAGAGCCTTCAAGTGCCAAACAGAGT
ATGTCCGATGGTATCTGGGTAAGAAGAAAGCAAAAGCAAGGGACCTTCATGCCCTTCTGATTCCCCTCCA
CCAAACCCCACTTCCCCTCATAAGTTTGTTTAAACACTTATCTTCTGGATTAGAATGCCGGTTAAATTCC
ATATGCTCCAGGATCTTTGACTGAAAAAAAAAAAGAAGAAGAAGAAGGAGAGCAAGAAGGAAAGATTTGT
GAACTGGAAGAAAGCAACAAAGATTGAGAAGCCATGTACTCAAGTACCACCAAGGGATCTGCCATTGGGA
CCCTCCAGTGCTGGATTTGATGAGTTAACTGTGAAATACCACAAGCCTGAGAACTGAATTTTGGGACTTC
TACCCAGATGGAAAAATAACAACTATTTTTGTTGTTGTTGTTTGTAAATGCCTCTTAAATTATATATTTA
TTTTATTCTATGTATGTTAATTTATTTAGTTTTTAACAATCTAACAATAATATTTCAAGTGCCTAGACTG
TTACTTTGGCAATTTCCTGGCCCTCCACTCCTCATCCCCACAATCTGGCTTAGTGCCACCCACCTTTGCC
ACAAAGCTAGGATGGTTCTGTGACCCATCTGTAGTAATTTATTGTCTGTCTACATTTCTGCAGATCTTCC
GTGGTCAGAGTGCCACTGCGGGAGCTCTGTATGGTCAGGATGTAGGGGTTAACTTGGTCAGAGCCACTCT
ATGAGTTGGACTTCAGTCTTGCCTAGGCGATTTTGTCTACCATTTGTGTTTTGAAAGCCCAAGGTGCTGA
TGTCAAAGTGTAACAGATATCAGTGTCTCCCCGTGTCCTCTCCCTGCCAAGTCTCAGAAGAGGTTGGGCT
TCCATGCCTGTAGCTTTCCTGGTCCCTCACCCCCATGGCCCCAGGCCCACAGCGTGGGAACTCACTTTCC
CTTGTGTCAAGACATTTCTCTAACTCCTGCCATTCTTCTGGTGCTACTCCATGCAGGGGTCAGTGCAGCA
GAGGACAGTCTGGAGAAGGTATTAGCAAAGCAAAAGGCTGAGAAGGAACAGGGAACATTGGAGCTGACTG
TTCTTGGTAACTGATTACCTGCCAATTGCTACCGAGAAGGTTGGAGGTGGGGAAGGCTTTGTATAATCCC
ACCCACCTCACCAAAACGATGAAGTTATGCTGTCATGGTCCTTTCTGGAAGTTTCTGGTGCCATTTCTGA
ACTGTTACAACTTGTATTTCCAAACCTGGTTCATATTTATACTTTGCAATCCAAATAAAGATAACCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001945.2
Synonyms DTR; DTS; DTSF; HEGFL
Summary Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor. [UniProtKB/Swiss-Prot Function]
Locus ID 1839
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents