RECK (NM_021111) Human 3' UTR Clone

CAT#: SC214511

3`UTR clone of reversion-inducing-cysteine-rich protein with kazal motifs (RECK) for miRNA target validation

Need custom modification / cloning service?
Get a free quote

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RECK (NM_021111) Human 3' UTR Clone
Vector pMirTarget
Symbol RECK
Synonyms ST15; ST15
ACCN NM_021111
Insert Size 1411
Sequence Data
>SC214511 3'UTR clone of NM_021111
The sequence shown below is from the reference sequence of NM_021111. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTTGCACTTGCTCTGGACATATAACTGACTGCCCACGGAAAGTGCAGAATGCTCCTCCACCTCACTCTCC
TGCCTTGAAAAAGACATTCAGGACTGCTGGTTTGTAGTTGAATATTGGCCAAGGAAAGGCACATGTCACC
TCTATTCGCCACACAGTATTTTTTTTTTTAATCCGCCAATATTAGTAGGATTTTTGTTTTGTTTTTACAA
ATGTTAAAATGTGTTGTTCCAAATACTAATGAAAACAGAATGTCTCTTCCTGGTAGACCACTGCCATATG
ATTTACATTTCCTCACCATAAGGGTCCCCCACTCTAAAGCAAATTTATCGCTGGGAAATGAGATGACCAC
TTTTTAGAAAGATAATTCACTGTACTATCAGGTTCACAAACTTCATTTCAGAGTTCTTTTTGAAGTATTT
AAGGTTCCCGTTGCATTTGTTTTGTTTACAGATAATTACCTACTCTGGCTAGAAGCTAGGGGTCCCAGTG
AAGAGCCACTGCCATTAAAGAATATGAAACATAGATAAAACATCTTTGAAATTATGTAAATTATGTAAAT
TATCAGGCAAATTTGCATTAAATTACAGAAATTTAATTCAGAACCCCAACTACTGTGTTATGCAAAAGCA
AGCTGATTAAATGACACTCATATAATTATATGTTGTAAGCAACAGGCTCACTGGTCACGGATTTGTGTCT
GTGACTTTTGTGAAAGGGAGAAGTGACATTGCATCAAAGCATCTTGCATTATGCAATTTTTATATTAACC
AGATATATATTCATCGGTATTCATCCAAGTTAAATGTAGAGTTTTTAAACATCAATCTTTAAACCAATTG
CTGCTACTTATATAATTGCCAAAAAGTGAAATAATGTGTAGTTCATGTAAATAATACATTATATTTCTAT
TTTATTATGAAGAAGGTGAATAGCCATATTTGTAAAATGACAATCATGTGTGTTAACCCAGTGCTTTCCA
TTCGTGAAAACACATTTGCTTTTTGTGATATGCACAATGTAGATAAGTGTTCTGTCTGACTTTCTTTTTT
GATATAGAAGTATAAAGAATTGTGGTTTATATATTTAAAAGTGTCAAGCTGAGTATTAAAATGTATGCAT
GTTGTCTAAGAAATTGAATACTTTGAATGTGTTTCACAGTTTGAAATAAGCTATTTGATGTAATACTTCT
TGTGTGTATGCACATGAACTTAGATTTTACATGAAGTATTTTTTCAGTATTATATGTACCCTCTGAAATA
CATAGGGATATGCGTATTATACCAAAATGTTGCTGAAAAATGGGCACTTAAAGCTTTCAGAATATGTCAG
TGCTGATGTAGCATGCTTGTTGCAATTGCCTTTTTTCTGTATAAATGTCTTTAATGCAATATACTGGAAA
GCTTTTCTATT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_021111.2
Synonyms ST15; ST15
Summary The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015].
Locus ID 8434
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents