PLEKHM2 (NM_015164) Human 3' UTR Clone

CAT#: SC210462

3' UTR clone of pleckstrin homology domain containing family M (with RUN domain) member 2 (PLEKHM2) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "PLEKHM2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PLEKHM2
Synonyms SKIP
ACCN NM_015164
Insert Size 865 bp
Sequence Data
>SC210462 3’UTR clone of NM_015164
The sequence shown below is from the reference sequence of NM_015164. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCCGAGCCTCCCGAGACCCCTGGTGCTGAGGCAGAGCTGGTTGGCGTCCCTGGTGGGCAGGAAAGGAA
GGCACGCCAGCCGGCAGGCACACTGTCACGGCTGTTGTCATGCTGTCGGGAGCCTACAGTCCACCCCTG
CCCTGGGCGGCAGAACCACCGAGTGTGGCTTAAGACAGGGTCCCTCCACTCCAGGGATCCAGATCAGGT
GCCCGGCACCCCTGGGCATCCTGCCCGACAGGTAGCGAATGGAGGTCGCTGGGGGCAGAGGGTCCGAGC
CCTGTGGGCTCTGCGGATGCACGCCCTCCTCCCGGGCCTCCGCCTCAGTCTGCAGAATTTCTGCCGAGT
GGCACCGAGAACACCATCCATCTAAGGACGAACAAAAGAACCAGGAGGGCGGGACCCCCCTCTTCCTCT
CCTGGGTTGGGGGCTGGGGCCCTGAGTGCCCAGCCATCCTTGTTCGTGTTTGAACACTCTCCTGGCCAC
GTGGGGAAGCGGGAACACGGGGTGTCTGCGCATGTTTCCTCCTCCTAGCTCCATCACTGCGCACACAGC
TGCCTGCCTCGCCAGATGCAGGGGGGCGGGCAGCCCTCCCTGGCTGCCAGGAGGCTCTGCATGCCCACA
GTCCTGCCCTGCCTGTCCCCTCAACCCGGCAGTGCCTGTAGCACCGAGGAGCAAAGGGGGTGGATGGGG
GGCTTGGAGAAGGGCGGAGCCCACCAGCCTGGCATCCATGTTGACATCTTCTGACTGTCCCCTGCTTGG
CTGGAGCCAGGCCCTTCCCTAGAGTTTCGTCAAGAGCCTCCTGGGGAAGGGGTCAGGTGGTTTGGGTTT
TGTTTTTTAAAATAAAATAGACATGTTATATTGCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_015164.4
Summary This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
Locus ID 23207
MW 30.6

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.