EYS (NM_001142800) Human 3' UTR Clone

CAT#: SC208145

3' UTR clone of eyes shut homolog (Drosophila) (EYS) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EYS
Synonyms bA74E24.1; bA166P24.2; bA307F22.3; C6orf178; C6orf179; C6orf180; dJ22I17.2; dJ303F19.1; dJ1018A4.2; EGFL10; EGFL11; RP25; SPAM
ACCN NM_001142800
Insert Size 646 bp
Sequence Data
>SC208145 3’UTR clone of NM_001142800
The sequence shown below is from the reference sequence of NM_001142800. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGGAGATGAACAAAATGAGGTTACATAAGTTAACACTAGAGATTTTAGTACACACTATACATAAATG
CAGTTATTTTGATAGTTATTTCTTTGATACATTGCTTACGGGGAATCAACTGTTTACTATATTACCTGA
AATAGTCTAAATGCTAACATATCTTTTTGATAAGATTGTAAAATGTCACTGAAGGTTCTGATTGTTTTT
CCTACATCTAATTTATCTGTATATATTTTGATTCATGTTTTAACTCCATTAGTTCAGTGCTTATTCACA
GAATGTGCTTATTCACTTTGCTTATTCACTTTTTACCTATCCCTAATGCTTACATTTTAAAATCAACGT
GTAAACACAATTTTAAAAATCAATGTGTAAGCTGAACTTTAAAATGTTTAAAATTCAGTTGGGAATGAA
TTAGGGATAGGTACAAATAAGAAAAAAATCAAGTTATTAATCAAAGGAAAAATAAAAATTATACAAAGC
AATGTAACCATATTGTATTACATGGCTTAGCTACAACTTATTTATATGATTCAACAATGTAAAACTTGA
ACATAGATTTAAACCAAAAATTATTGCATGAATGTAGAAAGAGAAGGTGAGAGGAGAGGAGAACAGGCT
GGTAAGAGCTAAATCCTTATCTTTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001142800.2
Summary The product of this gene contains multiple epidermal growth factor (EGF)-like and LamG domains. The protein is expressed in the photoreceptor layer of the retina, and the gene is mutated in autosomal recessive retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Locus ID 346007
MW 24.7

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.