p21 Ras (HRAS) (NM_176795) Human 3' UTR Clone

CAT#: SC207367

3' UTR clone of v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HRAS
• Synonyms: C-BAS/HAS; C-H-RAS; C-HA-RAS1; CTLO; H-RASIDX; HAMSV; HRAS1; p21ras; RASH1
• ACCN: NM_176795
• Insert Size: 563 bp
• Sequence Data:
  Insert Sequence

  >SC207367 3’UTR clone of NM_176795
  The sequence shown below is from the reference sequence of NM_176795. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ACCCTCTGGGACCCCCCGGGACCCATGTGACCCAGCGGCCCCTCGCGCTGGAGTGGAGGATGCCTTCTA
  CACGTTGGTGCGTGAGATCCGGCAGCACAAGCTGCGGAAGCTGAACCCTCCTGATGAGAGTGGCCCCGG
  CTGCATGAGCTGCAAGTGTGTGCTCTCCTGACGCAGGTGAGGGGGACTCCCAGGGCGGCCGCCACGCCC
  ACCGGATGACCCCGGCTCCCCGCCCCTGCCGGTCTCCTGGCCTGCGGTCAGCAGCCTCCCTTGTGCCCC
  GCCCAGCACAAGCTCAGGACATGGAGGTGCCGGATGCAGGAAGGAGGTGCAGACGGAAGGAGGAGGAAG
  GAAGGACGGAAGCAAGGAAGGAAGGAAGGGCTGCTGGAGCCCAGTCACCCCGGGACCGTGGGCCGAGGT
  GACTGCAGACCCTCCCAGGGAGGCTGTGCACAGACTGTCTTGAACATCCCAAATGCCACCGGAACCCCA
  GCCCTTAGCTCCCCTCCCAGGCCTCTGTGGGCCCTTGTCGGGCACAGATGGGATCACAGTAAATTATTG
  GATGGTCTTGA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_176795.5
• Summary: This gene belongs to the Ras oncogene family, whose members are related to the transforming genes of mammalian sarcoma retroviruses. The products encoded by these genes function in signal transduction pathways. These proteins can bind GTP and GDP, and they have intrinsic GTPase activity. This protein undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Mutations in this gene cause Costello syndrome, a disease characterized by increased growth at the prenatal stage, growth deficiency at the postnatal stage, predisposition to tumor formation, cognitive disability, skin and musculoskeletal abnormalities, distinctive facial appearance and cardiovascular abnormalities. Defects in this gene are implicated in a variety of cancers, including bladder cancer, follicular thyroid cancer, and oral squamous cell carcinoma. Multiple transcript variants, which encode different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 3265
• MW: 19.9