PRODH (NM_016335) Human 3' UTR Clone

CAT#: SC205472

3' UTR clone of proline dehydrogenase (oxidase) 1 (PRODH) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRODH
• Synonyms: HSPOX2; PIG6; POX; PRODH1; PRODH2; TP53I6
• ACCN: NM_016335
• Insert Size: 424 bp
• Sequence Data:
  Insert Sequence

  >SC205472 3’UTR clone of NM_016335
  The sequence shown below is from the reference sequence of NM_016335. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ACTGGCAACCTCTTCCATCGCCCTGCCTAGCACCCGCCAGCACACCCTTAGCCTCCAGCACCCCCCGCC
  CCCGCCCAGGCCATCACCACAGCTGCAGCCAACCCCATCCTCACACAGATTCACCTTTTTTCACCCCAC
  ACTTGCAGAGCTGCTGGAGGTGAGGTCAGGTGCCTCCCAGCCCTGCCCAGAGTATGGGCACTCAGGTGT
  GGGCCGAACCTGATACCTGCCTGGGACAGCCACTGGAAACTTTTGGGAACTCTCCTCGAATGTGTGGGC
  CCAAGGCCCCCACCTCTGTGACCCCCATGTCCTTGGACCTAGAGGATTGTCCACCTTCTGCCAAGGCCA
  GCCCACACAGCCCGAGCCCCTTGGGGAGCAGTGGCCGGGCTGGGGAGGCCTGCCTGGTCAATAAACCAC
  TGTTCCTGCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_016335.6
• Summary: This gene encodes a mitochondrial protein that catalyzes the first step in proline degradation. Mutations in this gene are associated with hyperprolinemia type 1 and susceptibility to schizophrenia 4 (SCZD4). This gene is located on chromosome 22q11.21, a region which has also been associated with the contiguous gene deletion syndromes, DiGeorge and CATCH22. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
• Locus ID: 5625
• MW: 15.1